• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Mentha X Piperita


Example Image
PLANiTS DNA barcode

Click for details-----ITS

CTGCAGCAGACCGCGAACACGTAATTAACTCCGCGGGCCACGGCGAGGGGGCGACCCCTTGCCGTGTCCCGTCTCCCGCCGGCGTGTTCCCTCGGGTCACGTCGTGCGGGCTAACGAACCCCGGCGCGGAATGCGCCAAGGAAAACCAAACGAAGCGTCCGCCCCCGGCATCCCGTTTGCGGAGCTTGCCGTGGGACCGGCCGTCTATCAAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCATCCCCGCGCCCCCACCCGGGCGGTTGGGGGCGGAGATTGGCCCCCCGTGCGCCTCGGTGCGCGGCCGGCCCAAATGCGATCCCCGGGCGGCTGGCGTCACGACAAGTGGTGGTTGAACATCTCAATCTCTCCTCGCAGCCGTGCCGCCGTGTCGTCCCGTACGGGAATCCACAAACGACCCAACGGTGCACGTCGCGAACAGCGTCTCACCTTCGACCGCGACCCCAGGTCAGGCGGA

Click for details-----ITS1

CGCATCCCGTCTCCTGCCGGCATGCTCCCTCAGAGTCGTGCGGGCTATCGAACCCCGGTGCGGAATGCATCAAGGAAAACCAAAAGAAGCGTCCGCCCCCGGCATCCCATTCGCGGGGTGTGCTATGGGATCGGGTGTCTATCAAATGTCAAAA

Click for details-----ITS2

ATCGCGTCGCCCCCATCCCCGCGCCCCCACCCGGGCGGTTGGGGGCGGAGATTGGCCCCCCGTGCGCCTCGGTGCGCGGCCGGCCCAAATGCGATCCCCGGGCGGCTGGCGTCACGACAAGTGGTGGTTGAACATCTCAATCTCTCCTCGCAGCCGTGCCGCCGTGTCGTCCCGTACGGGAATCCACAAACGACCCAACGGTGCACGTCGCGAACAGCGTCTCACCTTCGACCGCGACCCCAGGTCAGGCGGA
Taxonomic Information

Plant ID: NPO17752
Plant Latin Name: Mentha X Piperita
Taxonomy Genus: Mentha
Taxonomy Family: Lamiaceae

Plant External Links:

NCBI TaxonomyDB: 34256
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Brazil; Italy; Indonesia; India; Jordan; Switzerland

Traditional Medicine System:
Unani; Homeopathy

Geographical Distribution

Brazil; Italy; Indonesia; India; Jordan; Switzerland

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

154 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


123 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

111 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99734

Ingredient ID: NPC94167

Ingredient ID: NPC93888

Ingredient ID: NPC93843

Ingredient ID: NPC9218

Ingredient ID: NPC91546

Ingredient ID: NPC90767

Ingredient ID: NPC90464

Ingredient ID: NPC88566

Ingredient ID: NPC83987

Ingredient ID: NPC80170

Ingredient ID: NPC79056

Ingredient ID: NPC78551

Ingredient ID: NPC76145

Ingredient ID: NPC71092

Ingredient ID: NPC70850

Ingredient ID: NPC67761

Ingredient ID: NPC66655

Ingredient ID: NPC66624

Ingredient ID: NPC64850

Ingredient ID: NPC62765

Ingredient ID: NPC62045

Ingredient ID: NPC61

Ingredient ID: NPC60660

Ingredient ID: NPC60151

Ingredient ID: NPC59035

Ingredient ID: NPC58970

Ingredient ID: NPC55412

Ingredient ID: NPC55187

Ingredient ID: NPC52700

Ingredient ID: NPC50266

Ingredient ID: NPC491290

Ingredient ID: NPC491254

Ingredient ID: NPC490462

Ingredient ID: NPC490384

Ingredient ID: NPC490233

Ingredient ID: NPC490193

Ingredient ID: NPC490162

Ingredient ID: NPC490147

Ingredient ID: NPC490097

Ingredient ID: NPC490060

Ingredient ID: NPC489907

Ingredient ID: NPC4574

Ingredient ID: NPC45727

Ingredient ID: NPC45270

Ingredient ID: NPC44931

Ingredient ID: NPC43587

Ingredient ID: NPC38779

Ingredient ID: NPC38497

Ingredient ID: NPC34764

Ingredient ID: NPC331182

Ingredient ID: NPC328447

Ingredient ID: NPC326200

Ingredient ID: NPC317120

Ingredient ID: NPC313955

Ingredient ID: NPC312292

Ingredient ID: NPC309472

Ingredient ID: NPC307151

Ingredient ID: NPC306100

Ingredient ID: NPC303264

Ingredient ID: NPC301195

Ingredient ID: NPC29830

Ingredient ID: NPC295777

Ingredient ID: NPC295317

Ingredient ID: NPC294902

Ingredient ID: NPC291724

Ingredient ID: NPC290664

Ingredient ID: NPC287550

Ingredient ID: NPC287331

Ingredient ID: NPC286904

Ingredient ID: NPC286695

Ingredient ID: NPC283682

Ingredient ID: NPC281686

Ingredient ID: NPC278102

Ingredient ID: NPC272614

Ingredient ID: NPC271270

Ingredient ID: NPC270268

Ingredient ID: NPC269919

Ingredient ID: NPC265392

Ingredient ID: NPC259134

Ingredient ID: NPC252154

Ingredient ID: NPC250734

Ingredient ID: NPC250191

Ingredient ID: NPC239037

Ingredient ID: NPC23837

Ingredient ID: NPC237812

Ingredient ID: NPC235625

Ingredient ID: NPC231018

Ingredient ID: NPC230726

Ingredient ID: NPC226453

Ingredient ID: NPC226027

Ingredient ID: NPC225783

Ingredient ID: NPC222480

Ingredient ID: NPC221733

Ingredient ID: NPC220825

Ingredient ID: NPC219876

Ingredient ID: NPC219143

Ingredient ID: NPC213876

Ingredient ID: NPC213749

Ingredient ID: NPC209296

Ingredient ID: NPC208793

Ingredient ID: NPC203719

Ingredient ID: NPC203468

Ingredient ID: NPC20045

Ingredient ID: NPC19488

Ingredient ID: NPC19319

Ingredient ID: NPC190771

Ingredient ID: NPC189142

Ingredient ID: NPC187770

Ingredient ID: NPC185755

Ingredient ID: NPC183648

Ingredient ID: NPC18205

Ingredient ID: NPC180871

Ingredient ID: NPC178134

Ingredient ID: NPC17810

Ingredient ID: NPC176775

Ingredient ID: NPC176309

Ingredient ID: NPC175987

Ingredient ID: NPC174246

Ingredient ID: NPC167400

Ingredient ID: NPC166889

Ingredient ID: NPC166362

Ingredient ID: NPC165384

Ingredient ID: NPC16070

Ingredient ID: NPC160512

Ingredient ID: NPC159845

Ingredient ID: NPC1580

Ingredient ID: NPC157555

Ingredient ID: NPC156654

Ingredient ID: NPC154728

Ingredient ID: NPC154219

Ingredient ID: NPC152451

Ingredient ID: NPC150950

Ingredient ID: NPC14917

Ingredient ID: NPC147983

Ingredient ID: NPC13991

Ingredient ID: NPC138113

Ingredient ID: NPC137958

Ingredient ID: NPC13402

Ingredient ID: NPC133022

Ingredient ID: NPC131530

Ingredient ID: NPC126681

Ingredient ID: NPC124436

Ingredient ID: NPC122962

Ingredient ID: NPC118909

Ingredient ID: NPC115674

Ingredient ID: NPC11433

Ingredient ID: NPC114325

Ingredient ID: NPC114239

Ingredient ID: NPC112890

Ingredient ID: NPC112734

Ingredient ID: NPC109034

Ingredient ID: NPC108218

Ingredient ID: NPC107540