• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Centipeda Minima


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAATCCTGCAAAGCAGAACGACCCGTGCACATGTACCAACAACTTGGCTTTGTAGGGACCGTGCTTTTGTTCGGGCCTTATGAAGCCTTGTCGATGTGTGTTCATGGTGACCCCTTGGGGCCCTCATGGACTTTCATCGGCACAACAACAAACACCGGCACGGCATGTGCCAAGGAAAATTGAACTTAAGATGGGCTCGCATAATGATGCCCCTCTCTCGGTGTGCACATTGTACTGGTCCTCTCTTTAGTTAAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCTTCGGGTCGAGGGCACGTCTGCCTGGGTGTCACGCATCACGTCGCCCCCACCAACCATTCCCTTTAGGGATTTGTGTGATGGGGGCGGAGATTGGTCTCCCGTGCCTTTGGTGCGGTTGGCGAAAATAAGAGTCCCCTTTGACGGACACACGGCTAGTGGTGGTTGATAAGACCCTCGTCTCGTGTCGTGTGTTTGAGTCATAAGGGAAGACCTCTTTAGATACCCCAACGTGTTGTCTTTTGATGATGCTTCGA

Click for details-----ITS1

TCGAATCCTGCAAAGCAGAACGACCCGTGCACATGTACCAACAACTTGGCTTTGTAGGGACCGTGCTTTTGTTCGGGCCTTATGAAGCCTTGTCGATGTGTGTTCATGGTGACCCCTTGGGGCCCTCATGGACTTTCATCGGCACAACAACAAACACCGGCACGGCATGTGCCAAGGAAAATTGAACTTAAGATGGGCTCGCATAATGATGCCCCTCTCTCGGTGTGCACATTGTACTGGTCCTCTCTTTAGTTAAAAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO8881
Plant Latin Name: Centipeda Minima
Taxonomy Genus: Centipeda
Taxonomy Family: Asteraceae

Plant External Links:

NCBI TaxonomyDB: 397370
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Thailand; South Korea; China; India

Traditional Medicine System:
Sowa-Rigpa; TCM; Unani; Ayurveda; Siddha


Medicinal Functions:

Anodyne; Antitussive; Depurative; Diuretic; Skin; Sternutatory

Geographical Distribution

India; South Korea; China; Thailand

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

86 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


68 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

41 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99170

Ingredient ID: NPC88573

Ingredient ID: NPC72924

Ingredient ID: NPC71540

Ingredient ID: NPC70744

Ingredient ID: NPC63391

Ingredient ID: NPC62045

Ingredient ID: NPC59506

Ingredient ID: NPC59108

Ingredient ID: NPC49561

Ingredient ID: NPC38072

Ingredient ID: NPC37802

Ingredient ID: NPC36168

Ingredient ID: NPC328788

Ingredient ID: NPC307518

Ingredient ID: NPC306990

Ingredient ID: NPC302857

Ingredient ID: NPC299856

Ingredient ID: NPC294902

Ingredient ID: NPC293628

Ingredient ID: NPC29128

Ingredient ID: NPC289574

Ingredient ID: NPC287823

Ingredient ID: NPC286342

Ingredient ID: NPC285635

Ingredient ID: NPC284185

Ingredient ID: NPC281259

Ingredient ID: NPC279989

Ingredient ID: NPC278102

Ingredient ID: NPC271638

Ingredient ID: NPC26960

Ingredient ID: NPC266573

Ingredient ID: NPC265800

Ingredient ID: NPC265024

Ingredient ID: NPC26211

Ingredient ID: NPC261178

Ingredient ID: NPC258773

Ingredient ID: NPC256280

Ingredient ID: NPC256268

Ingredient ID: NPC253144

Ingredient ID: NPC252931

Ingredient ID: NPC251949

Ingredient ID: NPC247986

Ingredient ID: NPC245027

Ingredient ID: NPC241498

Ingredient ID: NPC24146

Ingredient ID: NPC230301

Ingredient ID: NPC219848

Ingredient ID: NPC219357

Ingredient ID: NPC216630

Ingredient ID: NPC213345

Ingredient ID: NPC210040

Ingredient ID: NPC209217

Ingredient ID: NPC208450

Ingredient ID: NPC20791

Ingredient ID: NPC20742

Ingredient ID: NPC200903

Ingredient ID: NPC196776

Ingredient ID: NPC192698

Ingredient ID: NPC186994

Ingredient ID: NPC182102

Ingredient ID: NPC178218

Ingredient ID: NPC1777

Ingredient ID: NPC170656

Ingredient ID: NPC167976

Ingredient ID: NPC167647

Ingredient ID: NPC162620

Ingredient ID: NPC161557

Ingredient ID: NPC157925

Ingredient ID: NPC157288

Ingredient ID: NPC156654

Ingredient ID: NPC15336

Ingredient ID: NPC1527

Ingredient ID: NPC147398

Ingredient ID: NPC146394

Ingredient ID: NPC140751

Ingredient ID: NPC130306

Ingredient ID: NPC122493

Ingredient ID: NPC120464

Ingredient ID: NPC117493

Ingredient ID: NPC115049

Ingredient ID: NPC113733

Ingredient ID: NPC111888

Ingredient ID: NPC10781

Ingredient ID: NPC1075

Ingredient ID: NPC105363