• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Lactuca Serriola


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAACCCTGCAAGGCAGAACGACCCGTGAACATGTAACCACAACGGGGTGACCGTGATAAGGGCCTCGGTCCTTATCCCCTAACCCTTCCCGACGTGAGTTCGTGGTGTCTTTTTTGGGGCATCATGGATTCCGTTGGACCATAACAAAACCCCGGCACGGTATGTGCCAAGGAAAACAAAAATGAGAAGGACACTACCTGTTTCGCCCCGTTTGCGGTGTGCGTACAGGTCGTGGCCTCCTTGGAATCACAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATCCGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCATCATTCCTCTCCTAACAGGTAGGCTTGGTGATAGGGGCGGAGATTGGTCTCCCGTGCTTTTTGTGTGGTTGGCCTAAAAAGGAGTCCCTTTCGGTGGATACACGGCTAGTGGTGGTTGTAAAGACCCTCTTTATGTGTTGTGTGTTGTGAGCTGCTAGGGTAACCCTCAACAAAGACCCCATTGTATCGTCTTGCGACGATGCTTCGACC

Click for details-----ITS1

NA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO7731
Plant Latin Name: Lactuca Serriola
Taxonomy Genus: Lactuca
Taxonomy Family: Asteraceae

Plant External Links:

NCBI TaxonomyDB: 75943
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
China; Italy; India

Traditional Medicine System:
Indian Folk; TCM; Unani; Ayurveda


Medicinal Functions:

Anodyne; Antipyretic; Diuretic; Homeopathy; Hypnotic; Narcotic; Sedative

Geographical Distribution

India; Italy; China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

64 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


25 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

25 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC9874

Ingredient ID: NPC9356

Ingredient ID: NPC91949

Ingredient ID: NPC88023

Ingredient ID: NPC79483

Ingredient ID: NPC74404

Ingredient ID: NPC68517

Ingredient ID: NPC65426

Ingredient ID: NPC45826

Ingredient ID: NPC42731

Ingredient ID: NPC39834

Ingredient ID: NPC37468

Ingredient ID: NPC312368

Ingredient ID: NPC302857

Ingredient ID: NPC294815

Ingredient ID: NPC287570

Ingredient ID: NPC282348

Ingredient ID: NPC281461

Ingredient ID: NPC268298

Ingredient ID: NPC258236

Ingredient ID: NPC254696

Ingredient ID: NPC251102

Ingredient ID: NPC246683

Ingredient ID: NPC246380

Ingredient ID: NPC240053

Ingredient ID: NPC238943

Ingredient ID: NPC222834

Ingredient ID: NPC215435

Ingredient ID: NPC214669

Ingredient ID: NPC213157

Ingredient ID: NPC212679

Ingredient ID: NPC210298

Ingredient ID: NPC209528

Ingredient ID: NPC20791

Ingredient ID: NPC206250

Ingredient ID: NPC203468

Ingredient ID: NPC202340

Ingredient ID: NPC200819

Ingredient ID: NPC199909

Ingredient ID: NPC195305

Ingredient ID: NPC1940

Ingredient ID: NPC19174

Ingredient ID: NPC188093

Ingredient ID: NPC186444

Ingredient ID: NPC184649

Ingredient ID: NPC184248

Ingredient ID: NPC181465

Ingredient ID: NPC176740

Ingredient ID: NPC171620

Ingredient ID: NPC1712

Ingredient ID: NPC157778

Ingredient ID: NPC14316

Ingredient ID: NPC142319

Ingredient ID: NPC140191

Ingredient ID: NPC135694

Ingredient ID: NPC13486

Ingredient ID: NPC130683

Ingredient ID: NPC12323

Ingredient ID: NPC118700

Ingredient ID: NPC116775

Ingredient ID: NPC114268

Ingredient ID: NPC112654

Ingredient ID: NPC110249

Ingredient ID: NPC107091