CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Commiphora Myrrha

Example Image

PLANiTS DNA barcode

Click for details-----ITS

CCGTAGGTGAAACCCTGCGGAAGGATCATTGTCGAAACCTGCCCAACAGCAGAACGACCCGCGAACCCGTTACATAGACAAAACACCCGTGTCGCGGGGGTCGGAGGCGTCCGGTCCGCGGGCGTCGGCCCGTGCCCCCGCGGCGTAACAACGAACCCGGCGCGGACCGCGCCAAGGAAACCATAACGAGAGAGCCCGCCGACCATCGCCCCGGAGACGGTGCGCGTGCGGTCGTCGGCGCCTTCTTTCACATTCGAAAACGACTCTCGGCAACGGATATCTAGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGTTAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTCGCCCCCCCCACCCCCCGCACCCCGGGGAGGAGCGCGGGCGGGGCGGAGACTGGCCTCCCGTGCGCCTCGCGGCTCGCGGTTGGCCCAAATCCGAGTCCCCCGGCCTCGCGTGCCGCGACTTTCGGTGGTCGAAAGAAACCCGATGCCCGTCGCGGCCGCACGGCCTTACAGTCGGACCCCGTGACCCCGACGCGTCGCCCGTAGAGCGACGCTCGCAACGCGACCCCAGGTCAGGCGGGA

Click for details-----ITS1

CCGCAGCAGAACGACCCGCGAACCCGTTTAGAGAAAACCCGTCGGGAGGGGCAGCGTGAGCTCCCCGCCCGTCCGCGGTCTGGGGGGTCGGAGGCGTCCCGTCCGCGGGCGTCGCCCGTGCTCCCGAGGCGCAACAACGAACTCGGCGCGGATTGCGCCAAGGAAGCCATACGTAACGGGAGAGCCCGTCGACCGTCGCCCCGGAGACGGTGCGCGTGCGGTCGGCGGTGCCCTCTTTCATTATCCAAAA

Click for details-----ITS2

ATCGTTGCCCCCCCACCCCCCCCACCCCGGGGAGGAGCGCGGGCGGGGCAGAGATTGGCCTCCCGTGCGCCTCGCGGCTCGCGGTTGGCCCAAATCCGAGTCCCACGGCCTCGCGTGCCGCGACTTTCGGTGGTCGAAAGAAACCCGATGCCCGTCGCGCTCGCGTGGCCGCACAGTCGGACCCCGTGACCCAACGCGTCTCCCGTACGGCGACGCTCGTAACGCGACCCCAGGTCAGGCGGGATC

Taxonomic Information

Plant ID: NPO7730
Plant Latin Name: Commiphora Myrrha
Taxonomy Genus: Commiphora
Taxonomy Family: Burseraceae

Plant External Links:

NCBI TaxonomyDB: 318982
Plant-of-the-World-Online: 127741-1

Used in Medicines

Country/Region:

China; Iraq; Jordan; India

Traditional Medicine System:

Sowa-Rigpa; TCM; Unani; Ayurveda; Siddha

Geographical Distribution

Eritrea; Yemen; India; Ethiopia; Djibouti; China; Somalia; Kenya; Jordan; Iraq

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

43 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

29 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

14 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC95868

Ingredient ID: NPC79576

Ingredient ID: NPC74304

Ingredient ID: NPC70271

Ingredient ID: NPC68425

Ingredient ID: NPC64292

Ingredient ID: NPC52456

Ingredient ID: NPC45947

Ingredient ID: NPC44422

Ingredient ID: NPC41667

Ingredient ID: NPC36002

Ingredient ID: NPC305426

Ingredient ID: NPC287890

Ingredient ID: NPC28318

Ingredient ID: NPC277073

Ingredient ID: NPC275287

Ingredient ID: NPC269206

Ingredient ID: NPC266040

Ingredient ID: NPC260363

Ingredient ID: NPC260268

Ingredient ID: NPC257124

Ingredient ID: NPC256887

Ingredient ID: NPC256035

Ingredient ID: NPC252067

Ingredient ID: NPC244515

Ingredient ID: NPC235059

Ingredient ID: NPC228974

Ingredient ID: NPC210987

Ingredient ID: NPC20764

Ingredient ID: NPC205618

Ingredient ID: NPC203912

Ingredient ID: NPC187095

Ingredient ID: NPC178394

Ingredient ID: NPC159481

Ingredient ID: NPC151593

Ingredient ID: NPC1513

Ingredient ID: NPC14930

Ingredient ID: NPC146245

Ingredient ID: NPC143979

Ingredient ID: NPC138556

Ingredient ID: NPC135692

Ingredient ID: NPC129652

Ingredient ID: NPC124436

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Therapeutic Target	Peptide receptor (family A GPCR)	TSHR	Thyroid stimulating hormone receptor	P16473	CHEMBL1963
Therapeutic Target	Structural protein	LMNA	Prelamin-A/C	P02545	CHEMBL1293235

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials
NP level	3

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT03452488	A Double-blind, Placebo Controlled, Randomized INTerventional Clinical Trial (SARA-INT)	sarcopenia	20-Hydroxyecdysone (NPC260268)	NP level
NCT04472728	Testing the Efficacy and Safety of BIO101 for the Prevention of Respiratory Deterioration in COVID-19 Patients	COVID-19	20-Hydroxyecdysone (NPC260268)	NP level
NCT04827537	Anti-protozoal Effect of Steroid Hormone 20-hydroxyecdysone	giardiasis	20-Hydroxyecdysone (NPC260268)	NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Diffuse large B-cell lymphomas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	ACHE,TSHR,LMNA
Other specified malignant neoplasms of kidney, except renal pelvis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90.Y	ACHE,TSHR
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	ACHE,LMNA
Superficial ovarian endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10.B4	ACHE,LMNA
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	ACHE,TSHR
Glioblastoma of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.00	TSHR,LMNA
Parkinsonism Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A00	ACHE
Substance abuse Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6C40	ACHE
Glaucoma Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9C61	ACHE
Hypo-thyroidism Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A00	TSHR
Alzheimer disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A20	ACHE
Unspecific substance harmful effect Disease Category: 22.Injury, poisoning or certain other consequences of external causes Disease ICD-11 Code: NE6Z	ACHE
Myasthenia gravis Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C6Y	ACHE
Pain, unspecified Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG3Z	ACHE
Pediculosis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1G00	ACHE
Dementia Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6D80-6D8Z	ACHE
Oesophageal/gastroduodenal disorder Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD90	ACHE
Mild neurocognitive disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6D71	ACHE
Parasitic worm infestation Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F90	ACHE
Thyroid cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D10	TSHR
Other specified disorders of muscles Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FB32.Y	NCT03452488
Giardiasis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1A31	NCT04827537
COVID-19 Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D6Y	NCT04472728
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	TSHR
Coeliac disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA95	TSHR
Serous cystadenoma,borderline malignancy of ovary Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73.4	TSHR
Pheochromocytoma Disease Category: X.Extension Codes Disease ICD-11 Code: XH3854	ACHE
Myelodysplastic syndromes, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A3Z	TSHR
Zika virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D48	ACHE
Malignant neoplasms of biliary tract, distal bile duct Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C15	LMNA
Leishmaniasis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F54	TSHR
Squamous cell carcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.2	TSHR
West Nile virus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D46	ACHE
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	LMNA
Malignant neoplasms of oesophagus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B70	ACHE
Cytomegaloviral disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D82	ACHE
Systemic lupus erythematosus Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A40.0	ACHE
Chikungunya virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D40	LMNA
Malignant neoplasms of thymus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C27	ACHE
Germ cell tumour of testis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80.2	ACHE
Ebola virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D60.01	ACHE

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Commiphora Myrrha

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

Country/Region:

Traditional Medicine System:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

43 All known Ingredients in Total

29 Ingredients with Acceptable Bioavailablity

14 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Diffuse large B-cell lymphomas

Other specified malignant neoplasms of kidney, except renal pelvis

Adenocarcinoma of pancreas

Superficial ovarian endometriosis

Adenocarcinoma of bronchus or lung

Glioblastoma of brain

Parkinsonism

Substance abuse

Glaucoma

Hypo-thyroidism

Alzheimer disease

Unspecific substance harmful effect

Myasthenia gravis

Pain, unspecified

Pediculosis

Dementia

Oesophageal/gastroduodenal disorder

Mild neurocognitive disorder

Parasitic worm infestation

Thyroid cancer

Other specified disorders of muscles

Giardiasis

COVID-19

Carcinosarcoma of uterus

Coeliac disease

Serous cystadenoma,borderline malignancy of ovary

Pheochromocytoma

Myelodysplastic syndromes, unspecified

Zika virus disease

Malignant neoplasms of biliary tract, distal bile duct

Leishmaniasis

Squamous cell carcinoma of bronchus or lung

West Nile virus infection

Mesothelioma of pleura

Malignant neoplasms of oesophagus

Cytomegaloviral disease

Systemic lupus erythematosus

Chikungunya virus disease

Malignant neoplasms of thymus

Germ cell tumour of testis

Ebola virus disease

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

>> Targets derived from weak experimental activities