• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Phellodendron Amurense


Example Image
PLANiTS DNA barcode

Click for details-----ITS

CTCTGCACAGCAGAACGACCCGCGAACTCGTGAAAACACCAGCGGGGGGGCGTGCTTCGCGGCCGCTCCCCCTGCCGCCGCGGGTGCGGGACTCGTCCCGTTCCCCGCGGGGGCGACCAACGAACCCCCGGCGCGGACTGCGCCAAGGAAATCTAACGAGAGAGCACGCCCCCGGGGCCCCCGGACACGGCGAGCCCCGGGACGCGGCGCCTTCTTTCACTCTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCTTTAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATTACGTCGCCCCCCACCCTGTGCCCGGCAAAGGGTTCTTGGGTGAGGGGGCGGATTTTGGCCCCCCGTGTGCCCTAGTTCGCGGTCGGCCTAAATACAAGTCTCGGGTGACGAACGTCACGACAAGTGGTGGATGTGATACCGTTGCATCATGTCGTGCACGTCTTGACCCCCCGGGTTATTTTGTTTCTGACCCCTAAAGCGCCGCTTCTGCGGAGCCTCGGTCGTGACCCCAGTCGCGATAAATCTAGAA

Click for details-----ITS1

TCGAAACCTCTGCACAGCAGAACGACCCGCGAACTCGTGAAAACACCAGCGGGGGGGCGTGCTTCGCGGCCGCTCCCCCTGCCGCCGCGGGTGCGGGACTCGTCCSGTTCCCCGCGGGGGCGACCAACGAACCCCCGGCGCGGACTGCGCCRRGGAAATCTARCGAGAGAGCACGCCCCCGGGGCCCCCGGACACGGCGAGCSCCGGGACGCGGCGCCTTCTTTCACTCTATCTATAA

Click for details-----ITS2

ATCGCTACCCCACCCCACCCCCACCCCGGGGGCCTGGAGGTACGGGCGGATAATGGCCTCCCATGCGCTCCCCGCTCGCGATTGGCCCAAATTTGAGTCCTCGGCGACCAGAGCTGCGACAATCGGTGGTGAAAATAAGCCTCTCGAGCTCACGCCGCGAGCCCGTGTCTAAGTTTTCGGGACTCAGGGACCTTGACACTCCGTACGAGCGGCGCTCGCA
Taxonomic Information

Plant ID: NPO24476
Plant Latin Name: Phellodendron Amurense
Taxonomy Genus: Phellodendron
Taxonomy Family: Rutaceae

Plant External Links:

NCBI TaxonomyDB: 68554
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
South Korea; China; Russia

Traditional Medicine System:
TCM; Kampo


Medicinal Functions:

Antibacterial; Bitter; Cholagogue; Diuretic; Expectorant; Hypoglycaemic; Ophthalmic; Skin; Stomachic; Vasodilator

Geographical Distribution

South Korea; China; Russia

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

117 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


89 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

66 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC98356

Ingredient ID: NPC95381

Ingredient ID: NPC93349

Ingredient ID: NPC92828

Ingredient ID: NPC91382

Ingredient ID: NPC91215

Ingredient ID: NPC90998

Ingredient ID: NPC88864

Ingredient ID: NPC85130

Ingredient ID: NPC84178

Ingredient ID: NPC81246

Ingredient ID: NPC81218

Ingredient ID: NPC79549

Ingredient ID: NPC78096

Ingredient ID: NPC77572

Ingredient ID: NPC75903

Ingredient ID: NPC75085

Ingredient ID: NPC7106

Ingredient ID: NPC70744

Ingredient ID: NPC6973

Ingredient ID: NPC68074

Ingredient ID: NPC63951

Ingredient ID: NPC59567

Ingredient ID: NPC58233

Ingredient ID: NPC57095

Ingredient ID: NPC53069

Ingredient ID: NPC51986

Ingredient ID: NPC51957

Ingredient ID: NPC4669

Ingredient ID: NPC45727

Ingredient ID: NPC44101

Ingredient ID: NPC41178

Ingredient ID: NPC36229

Ingredient ID: NPC36108

Ingredient ID: NPC34861

Ingredient ID: NPC34770

Ingredient ID: NPC327881

Ingredient ID: NPC326069

Ingredient ID: NPC316390

Ingredient ID: NPC310120

Ingredient ID: NPC308267

Ingredient ID: NPC307672

Ingredient ID: NPC306669

Ingredient ID: NPC306555

Ingredient ID: NPC305016

Ingredient ID: NPC302857

Ingredient ID: NPC300969

Ingredient ID: NPC298003

Ingredient ID: NPC296482

Ingredient ID: NPC293487

Ingredient ID: NPC290613

Ingredient ID: NPC29

Ingredient ID: NPC28469

Ingredient ID: NPC280717

Ingredient ID: NPC278799

Ingredient ID: NPC278068

Ingredient ID: NPC276588

Ingredient ID: NPC265082

Ingredient ID: NPC263265

Ingredient ID: NPC262870

Ingredient ID: NPC262635

Ingredient ID: NPC261831

Ingredient ID: NPC259732

Ingredient ID: NPC25810

Ingredient ID: NPC258019

Ingredient ID: NPC249045

Ingredient ID: NPC248355

Ingredient ID: NPC245212

Ingredient ID: NPC234017

Ingredient ID: NPC231382

Ingredient ID: NPC230301

Ingredient ID: NPC229235

Ingredient ID: NPC226143

Ingredient ID: NPC221754

Ingredient ID: NPC216459

Ingredient ID: NPC21429

Ingredient ID: NPC210460

Ingredient ID: NPC210437

Ingredient ID: NPC207721

Ingredient ID: NPC203450

Ingredient ID: NPC202768

Ingredient ID: NPC202605

Ingredient ID: NPC200555

Ingredient ID: NPC195291

Ingredient ID: NPC194283

Ingredient ID: NPC193798

Ingredient ID: NPC188953

Ingredient ID: NPC183485

Ingredient ID: NPC174554

Ingredient ID: NPC17312

Ingredient ID: NPC17273

Ingredient ID: NPC171409

Ingredient ID: NPC167976

Ingredient ID: NPC166040

Ingredient ID: NPC16452

Ingredient ID: NPC164203

Ingredient ID: NPC16107

Ingredient ID: NPC16066

Ingredient ID: NPC156422

Ingredient ID: NPC141612

Ingredient ID: NPC138488

Ingredient ID: NPC138487

Ingredient ID: NPC13826

Ingredient ID: NPC137949

Ingredient ID: NPC137167

Ingredient ID: NPC137153

Ingredient ID: NPC132097

Ingredient ID: NPC131885

Ingredient ID: NPC12987

Ingredient ID: NPC127674

Ingredient ID: NPC12053

Ingredient ID: NPC117986

Ingredient ID: NPC114721

Ingredient ID: NPC114526

Ingredient ID: NPC106786

Ingredient ID: NPC106295

Ingredient ID: NPC100980