CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Nitraria Schoberi

Example Image

PLANiTS DNA barcode

Click for details-----ITS

TGAACCTGCGGAAGGATCATTGTCGAAACCTGCACCACAGCAGAGCAACCCGCGAACACGTTTCACCACCGGGGGTAAATTTGGCCTTTTGGCCGTTTCCCCCCACCGCCCCGTGCGGTGCGAACAAACAAACCACGGCGCAACGCGCGCCAAGGAACATGAACGAACGAGAGAGCTTGCCTCTTTTCGATACATACGCAAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGTCAGGCCGAGGGCACGCCTGCCTGGGTGTCACGCATCGTTGCCCCCCCACCGTCTACGACGTGTGCGGGGAGCGGGAGATTGGCCTCCCGTGAGGGTGTTCCCTCGCGGTTGGCCCAAACACAGGGTCCCCCGGCCGAGGAAGCCGCGACTTTTCGGTGGTTGTTACCAAACAGACATGCCCTCTGTCGTGCTCTCCTCGTGCCCTTTTGCCGCCACCCTCGAACCTTAGGAAGGGCCAGCGCACTCTTTGAATAAGCTGCGCTCGCT

Click for details-----ITS1

Click for details-----ITS2

ATCGTTGCCCCCCCACCGTCTACGACGTGTGCGGGGAGCGGGAGATTGGCCTCCCGTGAGGGTGTTCCCTCGCGGTTGGCCCAAACACAGGGTCCCCCGGCCGAGGAAGCCGCGACTTTTCGGTGGTTGTTACCAAACAGACATGCCCTCTGTCGTGCTCTCCTCGTGCCCTTTTGCCGCCACCCTCGAACCTTAGGAAGGGCCAGCGCACTCTTTGAATAAGCTGCGCTCGCT

Taxonomic Information

Plant ID: NPO9551
Plant Latin Name: Nitraria Schoberi
Taxonomy Genus: Nitraria
Taxonomy Family: Nitrariaceae

Plant External Links:

NCBI TaxonomyDB: 1619328
Plant-of-the-World-Online: n.a.

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

2 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

2 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

2 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC220765

Ingredient ID: NPC218268

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Therapeutic Target	5HT3 receptor	HTR3A	Serotonin 3a (5-HT3a) receptor	P46098	CHEMBL1899
Therapeutic Target	Small molecule receptor (family A GPCR)	HTR1B	Serotonin 1b (5-HT1b) receptor	P28222	CHEMBL1898
Therapeutic Target	Small molecule receptor (family A GPCR)	HTR1E	Serotonin 1e (5-HT1e) receptor	P28566	CHEMBL2182
Therapeutic Target	Small molecule receptor (family A GPCR)	HTR2C	Serotonin 2c (5-HT2c) receptor	P28335	CHEMBL225
Therapeutic Target	Small molecule receptor (family A GPCR)	HTR5A	Serotonin 5a (5-HT5a) receptor	P47898	CHEMBL3426
Therapeutic Target	Small molecule receptor (family A GPCR)	HTR2A	Serotonin 2a (5-HT2a) receptor	P28223	CHEMBL224
Therapeutic Target	Small molecule receptor (family A GPCR)	HTR1F	Serotonin 1f (5-HT1f) receptor	P30939	CHEMBL1805
Therapeutic Target	Small molecule receptor (family A GPCR)	HTR1A	Serotonin 1a (5-HT1a) receptor	P08908	CHEMBL214
Therapeutic Target	Small molecule receptor (family A GPCR)	DRD2	Dopamine D2 receptor	P14416	CHEMBL217
Therapeutic Target	Small molecule receptor (family A GPCR)	DRD3	Dopamine D3 receptor	P35462	CHEMBL234
Therapeutic Target	Small molecule receptor (family A GPCR)	HTR7	Serotonin 7 (5-HT7) receptor	P34969	CHEMBL3155
Therapeutic Target	Small molecule receptor (family A GPCR)	HTR2B	Serotonin 2b (5-HT2b) receptor	P41595	CHEMBL1833
Therapeutic Target	Small molecule receptor (family A GPCR)	HTR1D	Serotonin 1d (5-HT1d) receptor	P28221	CHEMBL1983
Therapeutic Target	Small molecule receptor (family A GPCR)	HTR6	Serotonin 6 (5-HT6) receptor	P50406	CHEMBL3371
Therapeutic Target	Small molecule receptor (family A GPCR)	HTR4	Serotonin 4 (5-HT4) receptor	Q13639	CHEMBL1875

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials
NP level	1

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT01697579	Study of the Pharmacokinetics, Pharmacodynamics, Safety and Tolerability of Fosaprepitant for the Prevention of Chemotherapy-Induced Nausea and Vomiting (CINV) in Children (MK-0517-029)	Chemotherapy-induced nausea and vomiting	Serotonin (NPC220765)	NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Pituitary gland disorder Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A60-5A61	HTR1D,DRD2,HTR2B,HTR2C,HTR2A,HTR1B,HTR1E,HTR1F,HTR5A
Attention deficit hyperactivity disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A05	HTR2A,DRD3,DRD2,HTR2C,HTR1B,HTR2B,HTR7,HTR1A
Schizophrenia Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A20	HTR1A,DRD3,HTR2C,HTR6,DRD2,HTR7,HTR2A,HTR1B
Parkinsonism Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A00	DRD3,HTR1B,HTR6,HTR1A,HTR7,HTR2C,HTR2A,DRD2
Depression Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A70-6A7Z	HTR2B,DRD3,DRD2,HTR7,HTR2C,HTR1A,HTR2A
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	HTR1D,HTR2B,HTR2A,HTR7,HTR3C,DRD2,HTR1B
Psychotic disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A20-6A25	HTR1A,HTR1B,HTR2B,HTR2C,DRD2,HTR2A
Migraine Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A80	HTR2C,DRD2,HTR1A,HTR1D,HTR1F,HTR1B
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	HTR1D,HTR2A,HTR7,HTR1F,DRD2,HTR1B
Hepatocellular carcinoma of liver Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.02	HTR2C,HTR3A,HTR1D,HTR4,HTR1D,HTR4
Malignant neoplasms of thymus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C27	HTR2C,HTR2A,HTR7,HTR1F,DRD2,HTR5A
Anxiety Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MB24.3	HTR1A,HTR6,DRD2,HTR2C,HTR2A
Bipolar disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A60	DRD3,HTR7,HTR1A,HTR2A,DRD2
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	HTR2C,HTR1D,HTR6,HTR3A,HTR7
Squamous cell carcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.2	HTR2C,HTR3A,HTR1E,HTR7,DRD2
Cytomegaloviral disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D82	HTR1D,HTR6,HTR3A,HTR7,DRD2
Mild neurocognitive disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6D71	HTR4,HTR6,HTR7,HTR1A
Mood disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A60-6E23	HTR1D,HTR1A,HTR2A,HTR1B
Pulmonary hypertension Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BB01	DRD2,HTR1A,DRD2,HTR2B
Insomnia Disease Category: 07.Sleep-wake disorders Disease ICD-11 Code: 7A00-7A0Z	HTR1A,DRD2,HTR1D,HTR2A
Nausea/vomiting Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MD90	HTR3A,DRD2,HTR4 NCT01697579
Psoriasis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA90	HTR1A,DRD2 HTR3A,HTR7
Sexual dysfunction Disease Category: 17.Conditions related to sexual health Disease ICD-11 Code: HA00-HA01	DRD3,HTR2A,HTR1A,DRD2
Serous cystadenoma,borderline malignancy of ovary Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73.4	HTR2C,HTR1D,HTR6,DRD2
Hepatoblastoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.01	HTR1D,HTR4,HTR1B,HTR1F
Other specified malignant neoplasms of kidney, except renal pelvis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90.Y	HTR3A,HTR1D,HTR6,HTR7
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	HTR2C,HTR1D,HTR2B,HTR3A
Invasive carcinoma of breast Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C61	HTR2C,HTR1D,HTR3A,HTR1E
Germ cell tumour of testis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80.2	HTR2C,HTR1D,HTR3A,HTR1B
Malignant neoplasms of adrenal gland Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D11	HTR2C,HTR1E,HTR1F,HTR5A
Gastroduodenal motor/secretory disorder Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA41	HTR4,DRD2,DRD3
Tonus and reflex abnormality Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MB47	HTR1B,HTR2C,HTR1A
Dementia Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6D80-6D8Z	HTR1A,HTR2A,HTR1D
Malignant haematopoietic neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B33	HTR1A,HTR1B,HTR2C
Malignant neoplasm metastasis in lymph nodes of head, face or neck Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D60.0	HTR2C,HTR1D,HTR7
Other specified malignant neoplasms ofcolon Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B90.Y	HTR2C,HTR1D,DRD2
Malignant neoplasms of corpus uteri, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.Z	HTR2C,HTR6,HTR3A
Renal cell carcinoma, chromophobe type Disease Category: X.Extension Codes Disease ICD-11 Code: XH6153	HTR4,HTR3A,DRD2
Carpal tunnel syndrome Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C10.0	HTR2B,HTR2A,HTR6
Endometrial cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76	DRD2,DRD3
Mature T-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A90	DRD3,DRD2
Sleep-wake disorder Disease Category: 07.Sleep-wake disorders Disease ICD-11 Code: 7A00-7B2Z	HTR2A,HTR2C
Glaucoma Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9C61	HTR2A,DRD2
Schizoaffective disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A21	DRD2,HTR2A
Chronic kidney disease Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GB61	HTR2A,DRD2
Epilepsy/seizure Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A61-8A6Z	HTR3A,HTR1D
Irritable bowel syndrome Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD91	HTR4,HTR3A
Brain cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00	DRD2,DRD3
Acute upper respiratory infection Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA07	DRD3,DRD2
Chronic pain Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG30	HTR2A,HTR3A
Solid tumour/cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00-2F9Z	DRD2,DRD3
Stomach cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72	DRD3,DRD2
Obesity Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5B80-5B81	HTR6,HTR2C
Substance abuse Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6C40	DRD2,HTR2C
Acute diabete complication Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A2Y	HTR2C,HTR2A
Social anxiety disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6B04	HTR1A,HTR2A
Post-traumatic stress disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6B40	HTR2A,HTR4
Chronic insomnia Disease Category: 07.Sleep-wake disorders Disease ICD-11 Code: 7A00	HTR2A,HTR2C
Cardiovascular disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA00-BE2Z	HTR2A,DRD2
BCR-ABL1-negative chronic myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A41	DRD3,DRD2
Pancreatic cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10	DRD2,HTR2A
Cerebral ischaemia Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B1Z	DRD2,HTR2A
Intellectual development disorder Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LD90	HTR1A,DRD2
Psychoactive substances use disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6C4G	DRD3,HTR2C
Type 2 diabetes mellitus Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A11	DRD2,HTR2A
Heart failure Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD10-BD1Z	DRD2,HTR4
Pain, unspecified Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG3Z	DRD2,HTR2C
Digestive system disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DE2Z	DRD2,HTR4
Multiple myeloma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A83	DRD3,DRD2
Idiopathic interstitial pneumonitis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CB03	HTR2A,DRD2
Malignant neoplasms of biliary tract, distal bile duct Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C15	HTR3A,HTR1D
Diffuse large B-cell lymphomas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	HTR3A,HTR2B
Melanoma of skin Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C30	HTR2C,HTR1D
Other specified malignant neoplasms of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.Y	HTR2C,HTR3A
Pheochromocytoma Disease Category: X.Extension Codes Disease ICD-11 Code: XH3854	HTR1D,HTR2A,HTR6,HTR3A,HTR1E,HTR7,HTR1F,DRD2,HTR1B,HTR1A,HTR5A
Alzheimer disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A20	HTR1D,HTR1A,HTR7,DRD3,HTR2A,DRD2,HTR6,HTR4,HTR1B,HTR2C
Postpartum haemorrhage Disease Category: 18.Pregnancy, childbirth or the puerperium Disease ICD-11 Code: JA43	DRD2
Gangrene Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MC85	DRD2
Lung cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25	DRD2
Itching Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F28-1G07	DRD2
Inborn porphyrin/heme metabolism error Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C58	DRD2
Essential hypertension Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA00	DRD2
Dissociative neurological symptom disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6B60	HTR6
Thyrotoxicosis Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A02	DRD2
Nasopharyngeal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B6B	DRD3
Hypoactive sexual desire dysfunction Disease Category: 17.Conditions related to sexual health Disease ICD-11 Code: HA00	HTR1A
Bulimia nervosa Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6B81	HTR1A
Asthma Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA23	DRD2
Restless legs syndrome Disease Category: 07.Sleep-wake disorders Disease ICD-11 Code: 7A80	DRD2
Neurodegenerative disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A20-8A23	HTR6
Carcinoid syndrome Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5B10	DRD2
Coronary atherosclerosis Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA80	HTR1A
Skin/mucosal anomaly Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LD27	HTR1A
Ejaculatory dysfunction Disease Category: 17.Conditions related to sexual health Disease ICD-11 Code: HA03	HTR1A
Muscular atrophy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B61	HTR1A
Endocrine gland neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2F37	DRD2
Hyperaemia Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9A61-9B7Y	DRD2
Choreiform disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A01	DRD2
Dyspepsia Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MD92	HTR4
General pain disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8E43	DRD2
Gastro-oesophageal reflux disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA22	HTR4
Supraventricular tachyarrhythmia Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BC81	HTR4
Allergic/hypersensitivity disorder Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A80-4A8Z	DRD2
Juvenile idiopathic arthritis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA24	HTR1A
Faecal incontinence Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: ME07	DRD2
Corneal disease Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9A76-9A78	HTR3A
NA Disease Category: NA Disease ICD-11 Code: NA	DRD2
Postoperative inflammation Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1A00-CA43	HTR1A
Hypotension Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA20-BA21	DRD2
Breathing abnormality Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MD11	DRD2
Dengue fever, unspecified Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D2Z	DRD3
Leishmaniasis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F54	HTR7
Idiopathic pulmonary fibrosis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CB03.4	HTR2A
Adenocarcinoma of stomach Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72.0	HTR2C
Malignant neoplasms of oesophagus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B70	HTR1D
Urothelial carcinoma of bladder Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C94.2	HTR2C
Systemic lupus erythematosus Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A40.0	DRD2
Malignant neoplasms of thyroid gland, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D10.Z	HTR1D
Chikungunya virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D40	HTR4
Heart failure, unspecified Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD1Z	HTR2A
Human immunodeficiency virus disease without mention of tuberculosis or malaria Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1C62	HTR3A

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Nitraria Schoberi

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

2 All known Ingredients in Total

2 Ingredients with Acceptable Bioavailablity

2 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Pituitary gland disorder

Attention deficit hyperactivity disorder

Schizophrenia

Parkinsonism

Depression

Adenocarcinoma of pancreas

Psychotic disorder

Migraine

Mesothelioma of pleura

Hepatocellular carcinoma of liver

Malignant neoplasms of thymus

Anxiety

Bipolar disorder

Carcinosarcoma of uterus

Squamous cell carcinoma of bronchus or lung

Cytomegaloviral disease

Mild neurocognitive disorder

Mood disorder

Pulmonary hypertension

Insomnia

Nausea/vomiting

Psoriasis

Sexual dysfunction

Serous cystadenoma,borderline malignancy of ovary

Hepatoblastoma

Other specified malignant neoplasms of kidney, except renal pelvis

Adenocarcinoma of bronchus or lung

Invasive carcinoma of breast

Germ cell tumour of testis

Malignant neoplasms of adrenal gland

Gastroduodenal motor/secretory disorder

Tonus and reflex abnormality

Dementia

Malignant haematopoietic neoplasm

Malignant neoplasm metastasis in lymph nodes of head, face or neck

Other specified malignant neoplasms ofcolon

Malignant neoplasms of corpus uteri, unspecified

Renal cell carcinoma, chromophobe type

Carpal tunnel syndrome

Endometrial cancer

Mature T-cell lymphoma

Sleep-wake disorder

Glaucoma

Schizoaffective disorder

Chronic kidney disease

Epilepsy/seizure

Irritable bowel syndrome

Brain cancer

Acute upper respiratory infection

Chronic pain

Solid tumour/cancer

Stomach cancer

Obesity

Substance abuse

Acute diabete complication

Social anxiety disorder

Post-traumatic stress disorder

Chronic insomnia

Cardiovascular disease

BCR-ABL1-negative chronic myeloid leukaemia

Pancreatic cancer

Cerebral ischaemia

Intellectual development disorder

Psychoactive substances use disorder