• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Senna Obtusifolia


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGTTGCCTCACAAACGGGACCACTCGCGAATTGGTTGAAACACTCCCGAGGCGGTAGACGAGCGGCGTGCGTCGCCCTGAGTCCCCCGCTCGGTGCCCGGGTGCTAACTATAGCCTCGGGCAACCCCAATAAAAACCCCGGCGCTGGTTGCGCCAAGGAAATAAAGCTTACGTGTGTGGCCTCGGCGAATCGTAGACGGTTCTTGTCCGGGGCCGTGACGAAAATGAAATTAAAAATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATTGCTGTCCCAAACCCAGACGCCCCTCGAACTGATCGGAGGGGGGGAGGCGCTTGGGCGAAAGTTGGCCTCCCGCGAGCATTGCCTCGCGGATGGTTGAAAAACGAGCCCACGAGTGATGACCGCCACGTTCACGGTGGACGAGCGAAAGCCTCGAGCCCGACCGTGCGCATGATGTCCCTTTGTCTAGGCTGCGAGACCCGTGCAAGCAAGAAAGCGCTCACAACGCGACCCCAGTCA

Click for details-----ITS1

NA

Click for details-----ITS2

ATCGTAGCCCCAAGCCACGTCCMCCCCCCCGATTGATCAGGGGCGACGAGGTGCTTGGGGGGAATTTGGCCTCCCGTGATCCGTGCATTGCGGATGGCCGAAAAAGGAGCCTGTGCGGGGCAATCGCCACGTTCCACGGTGGATGAGCAGATGCCTCGAGACCGACCTTGTGTTGGTTGTCCCTACGGATGGGCTGTCAGACCCTTTGGGAGCGCCGAAGCTTTCCCG
Taxonomic Information

Plant ID: NPO8921
Plant Latin Name: Senna Obtusifolia
Taxonomy Genus: Senna
Taxonomy Family: Fabaceae

Plant External Links:

NCBI TaxonomyDB: 346985
Plant-of-the-World-Online: 234560-2

Used in Medicines

Country/Region:
Kenya; Tanzania; Rwanda; India; Thailand

Traditional Medicine System:
Ayurveda; Kampo

Geographical Distribution

Brazil; Madagascar; Bangladesh; Kenya; Sudan; Guinea; Mali; Costa Rica; Bahamas; Ethiopia; Rwanda; Somalia; Peru; Suriname; Argentina; Bolivia; Cameroon; Burkina Faso; Ecuador; Benin; Ghana; Saudi Arabia; Australia; Libya; Togo; Thailand; Venezuela; Cape Verde; Cote d'Ivoire; Sri Lanka; Trinidad and Tobago; Zimbabwe; Oman; Senegal; Dominican Republic; Belize; Sierra Leone; Nigeria; Eritrea; Netherlands; Uganda; Liberia; Pakistan; Gambia; Tanzania; Zambia; United States; Paraguay; Mauritania; French Guiana; Guinea-Bissau; Guyana; Namibia; Honduras; Malawi; Yemen; Haiti; Jamaica; Iraq; Angola; Chad; Mexico; India; Botswana; Djibouti; Congo; Mozambique; Colombia; Burundi; Gabon; Niger; Nicaragua; Comoros

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available
Compounds Summary

Overview of Ingredients

39 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


32 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

29 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.





Ingredient Structrual Cards

Ingredient ID: NPC96915

Ingredient ID: NPC91478

Ingredient ID: NPC88466

Ingredient ID: NPC70622

Ingredient ID: NPC676

Ingredient ID: NPC65597

Ingredient ID: NPC5379

Ingredient ID: NPC479027

Ingredient ID: NPC37543

Ingredient ID: NPC3224

Ingredient ID: NPC312929

Ingredient ID: NPC302783

Ingredient ID: NPC297532

Ingredient ID: NPC294226

Ingredient ID: NPC290613

Ingredient ID: NPC29

Ingredient ID: NPC289042

Ingredient ID: NPC288089

Ingredient ID: NPC282923

Ingredient ID: NPC271632

Ingredient ID: NPC256263

Ingredient ID: NPC254848

Ingredient ID: NPC254847

Ingredient ID: NPC245584

Ingredient ID: NPC245531

Ingredient ID: NPC2316

Ingredient ID: NPC230301

Ingredient ID: NPC22523

Ingredient ID: NPC213052

Ingredient ID: NPC212290

Ingredient ID: NPC199463

Ingredient ID: NPC199357

Ingredient ID: NPC19256

Ingredient ID: NPC173978

Ingredient ID: NPC161794

Ingredient ID: NPC146837

Ingredient ID: NPC146803

Ingredient ID: NPC14561

Ingredient ID: NPC103540

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM
Target Type: Individual Protein of Homo sapiens
*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.
.

Detailed Information of Target Proteins

Target Type Protein Class Gene ID Protein Name Uniprot ID Target ChEMBL ID
Cytochrome P450 Cytochrome P450 family 1 CYP1B1 Cytochrome P450 1B1 Q16678 CHEMBL4878
Therapeutic Target Oxidoreductase HSD17B10 Endoplasmic reticulum-associated amyloid beta-peptide-binding protein Q99714 CHEMBL4159
Therapeutic Target Phosphodiesterase TDP1 Tyrosyl-DNA phosphodiesterase 1 Q9NUW8 CHEMBL1075138
Therapeutic Target Structural protein LMNA Prelamin-A/C P02545 CHEMBL1293235
Therapeutic Target Threonine protease PSMB1 Proteasome component C5 P20618 CHEMBL4208
Clinical Trials Summary
Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type Number of clinical trials
Plant level1
Clinical trial details
NCT ID Title Condition Form in clinical use Associated by plant or compound
NCT04252131 Therapeutic Effect of Cassia Seed in Obesity of Patients With Schizophrenia Schizophrenia Senna Obtusifolia Plant level
As single plant

❱❱❱ Associated Human Diseases and Detailed Association Evidence

 How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
 ❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant
Association Type & Detailed Evidence
Diffuse large B-cell lymphomas
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A81
 CSNK2A1,ESR2,HSD17B10,TDP1,CSNK2A2,PSMB1,LMNA
Serous cystadenoma,borderline malignancy of ovary
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C73.4
 CSNK2A1,TDP1,ESR1
Malignant neoplasms of biliary tract, distal bile duct
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C15
 CSNK2A1,ESR2,LMNA
Adenocarcinoma of pancreas
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C10.0
 F2,CYP1B1,LMNA
Mesothelioma of pleura
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C26.0
 CSNK2A2,TDP1,LMNA
Malignant neoplasms of thymus
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C27
 HSD17B10,CYP1B1,PSMB1
Multiple sclerosis
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A40
 ESR1,F2
Prostate cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C82
 ESR1,ESR2
Menopausal disorder
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA30
 ESR2,ESR1
Breast cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C60-2C6Y
 ESR2,ESR1
Solid tumour/cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00-2F9Z
 ESR1,CSNK2A1
Hyper-lipoproteinaemia
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5C80
 ESR2,ESR1
Carcinosarcoma of uterus
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C76.43
 HSD17B10,TDP1
Glioblastoma of brain
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00.00
 CYP1B1,LMNA
Carpal tunnel syndrome
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C10.0
 CYP1B1,ESR1
Schizophrenia
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6A20
 NCT04252131
Hepatitis virus infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1E50-1E51
 ESR2
Thrombocytopenia
Disease Category: 03.Diseases of the blood or blood-forming organs
Disease ICD-11 Code: 3B64
 F2
Angina pectoris
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA40
 F2
Acquired prion disease
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8E01
 ESR1
Prostate hyperplasia
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA90
 ESR2
Low bone mass disorder
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FB83
 ESR1
Acne vulgaris
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: ED80
 ESR1
Asthma
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CA23
 F2
Coronary thrombosis
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA43
 F2
Male infertility
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GB04
 ESR1
Sepsis
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1G40-1G41
 ESR2
Alzheimer disease
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A20
 ESR2
Nutritional deficiency
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5B50-5B71
 F2
Unspecified viral infection of unspecified site
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D9Z
 ESR1
Myocardial infarction
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA41-BA43
 F2
Coronavirus infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D92
 CSNK2A1
Cushing syndrome
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A70
 ESR2
Cardiovascular disease
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA00-BE2Z
 F2
Diabetes mellitus, type unspecified
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A14
 ESR1
Vaginitis
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA02
 ESR1
Skeletal anomaly
Disease Category: 20.Developmental anomalies
Disease ICD-11 Code: LD24
 ESR1
Pituitary gland disorder
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A60-5A61
 ESR1
Indeterminate colitis
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DD72
 ESR2
Female pelvic pain
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA34
 ESR1
Female infertility
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA31
 ESR1
Endometriosis
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA10
 ESR1
Coagulation defect
Disease Category: 03.Diseases of the blood or blood-forming organs
Disease ICD-11 Code: 3B10
 F2
Adrenal cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D11
 ESR1
Female genital tract noninflammatory disorder
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA1Y
 ESR1
Brain cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00
 ESR1
Breast in situ carcinoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2E65
 ESR1
Type 2 diabetes mellitus
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A11
 F2
Cerebral ischaemic stroke
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8B11
 F2
Bleeding disorder
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA20-GA21
 F2
Ischaemic/haemorrhagic stroke
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8B20
 F2
Liver cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C12
 CSNK2A1
Dyspareunia
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA12
 ESR1
Metastatic tumour
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D50-2E2Z
 ESR1
Vasomotor/allergic rhinitis
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CA08
 ESR2
Menstrual cycle bleeding disorder
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA20
 ESR1
Thrombosis
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DB61-GB90
 F2
Adenocarcinoma of stomach
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B72.0
 F2
Malignant neoplasm metastasis in lymph nodes of head, face or neck
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D60.0
 F2
Squamous cell carcinoma of bronchus or lung
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25.2
 F2
Tetralogy of Fallot
Disease Category: 20.Developmental anomalies
Disease ICD-11 Code: LA88.2
 F2
Other specified malignant neoplasms ofcolon
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B90.Y
 F2
Other specified malignant neoplasms of kidney, except renal pelvis
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C90.Y
 F2
Superficial ovarian endometriosis
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA10.B4
 LMNA
Cytomegaloviral disease
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D82
 ESR2
Malignant neoplasms of thyroid gland, unspecified
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D10.Z
 CYP1B1
Adenocarcinoma of bronchus or lung
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25.0
 F2
Malignant neoplasms of corpus uteri, unspecified
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C76.Z
 F2
Chikungunya virus disease
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D40
 LMNA
Invasive carcinoma of breast
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C61
 ESR1
Heart failure, unspecified
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BD1Z
 CYP1B1
Germ cell tumour of testis
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C80.2
 F2

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network 
Data Section
Select to Download
1. General Info & Plant Usage & Geographical Distribution  
2. Plant Ingredients  
3. Collective Molecular Proteins  
4. Collective Enriched Activities  
5. Plant molecular targets overlapping with DEGs  
6. Associated clinical trials  
7. Associated Human Diseases  
>> Targets derived from weak experimental activities
About Us

The CMAUP database is developed by the Bioinformatics & Drug Design group (BIDD) and School of Pharmacy, Fudan University.

CMAUP

Home

About

Browse

Help

Useful links

BIDD home

NPASS database

TCM-ID database

TTD database

Contact

826 Zhangheng Road, Pudong New District, Shanghai, China

Principle Investigator:
Prof. Chen Yu Zong
chenyuzong@sz.tsinghua.edu.cn
Prof. Zeng Xian
zengxian@fudan.edu.cn

Developer & Maintainer:
Ph.D. Student Dongyue Hou
dyhou22@m.fudan.edu.cn
Mr. Hanbo Lin
hblin19@fudan.edu.cn
Ms. Yuhan Feng
yhfeng22@m.fudan.edu.cn

© 2023 Copyright: Bioinformatics & Drug Design group