CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Vitex Agnus-Castus

Example Image

PLANiTS DNA barcode

Click for details-----ITS

TGTCGAAACCTGCAAATGAGACCGCGAACACGTGTTTTACCGCAACGGGGACGCGGCGCGGGGCGAGCGTGCCTCCCTCCCGTCGCGTTCCCACCCCCGTCGGCACGGGCGCCATCGCCTCGTGTCGTGCGGGCTAACGAACCCCGGCGCGGCATGCGCCAAGGAAAACAAAAATGAAGCGTTCGCCGCCCGACGCCCCGTTCCGGAGCGCGCGGGCGGACGGTGCGCCTTTCTAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCCTCCTGCGCATCGCGTCGCGATGGGGGGGCGGAGACTGGCCTCCCGTGCCCCTCGGCGCGGCTGGCCCAAATGCGATCCCTTCGGCGACGCACGTCACGACCAGTGGTGGTTGATCTCAACTCGCGTGCTGTCGTGCGGCGCGGCGTCGTCCGCAGTGGAGTCAACGATAACGATGACCCAACGGTGCATGCGCGCCTACGACC

Click for details-----ITS1

Click for details-----ITS2

ATCGCGTCGCCCCCCCTCCTGCGCATCGCGTCGCGATGGGGGGGCGGAGACTGGCCTCCCGTGCCCCTCGGCGCGGCTGGCCCAAATGCGATCCCTTCGGCGACGCACGTCACGACCAGTGGTGGTTGATCTCAACTCGCGTGCTGTCGTGCGGCGCGGCGTCGTCCGCAGTGGAGTCAACGATAACGATGACCCAACGGTGCATGCGCGCCTACGACC

Taxonomic Information

Plant ID: NPO7728
Plant Latin Name: Vitex Agnus-Castus
Taxonomy Genus: Vitex
Taxonomy Family: Lamiaceae

Plant External Links:

NCBI TaxonomyDB: 54477
Plant-of-the-World-Online: 865568-1

Used in Medicines

Country/Region:

Brazil; Australia; Italy; India; France; Jordan; Germany

Traditional Medicine System:

Unani; Homeopathy

Medicinal Functions:

Anaphrodisiac; Aphrodisiac; Diaphoretic; Diuretic; Febrifuge; Galactogogue; Infertility; Ophthalmic; Sedative; Stomachic; Women's complaints

Geographical Distribution

Brazil; Afghanistan; Italy; Turkmenistan; France; Peru; Australia; Iran; Algeria; Cuba; Russia; Jordan; Germany; Dominican Republic; Iraq; Spain; Libya; Turkey; United States; Morocco; Haiti; Bulgaria; Pakistan; Albania; Honduras; Mexico; Egypt; Nicaragua; India; Tunisia; Greece; Cyprus

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

38 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

24 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

20 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC7349

Ingredient ID: NPC60019

Ingredient ID: NPC5286

Ingredient ID: NPC50898

Ingredient ID: NPC49659

Ingredient ID: NPC48288

Ingredient ID: NPC35141

Ingredient ID: NPC324841

Ingredient ID: NPC32441

Ingredient ID: NPC312379

Ingredient ID: NPC311142

Ingredient ID: NPC310817

Ingredient ID: NPC307063

Ingredient ID: NPC292419

Ingredient ID: NPC289906

Ingredient ID: NPC282169

Ingredient ID: NPC277570

Ingredient ID: NPC270849

Ingredient ID: NPC265551

Ingredient ID: NPC263667

Ingredient ID: NPC262826

Ingredient ID: NPC250260

Ingredient ID: NPC248702

Ingredient ID: NPC237779

Ingredient ID: NPC235621

Ingredient ID: NPC234536

Ingredient ID: NPC225434

Ingredient ID: NPC212730

Ingredient ID: NPC210003

Ingredient ID: NPC204044

Ingredient ID: NPC196330

Ingredient ID: NPC190987

Ingredient ID: NPC179950

Ingredient ID: NPC174396

Ingredient ID: NPC16899

Ingredient ID: NPC124183

Ingredient ID: NPC123965

Ingredient ID: NPC120150

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Cytochrome P450	Cytochrome P450 family 1	CYP1A1	Cytochrome P450 1A1	P04798	CHEMBL2231
Cytochrome P450	Cytochrome P450 family 1	CYP1A2	Cytochrome P450 1A2	P05177	CHEMBL3356
Cytochrome P450	Cytochrome P450 family 1	CYP1B1	Cytochrome P450 1B1	Q16678	CHEMBL4878
Cytochrome P450	Cytochrome P450 family 19	CYP19A1	Cytochrome P450 19A1	P11511	CHEMBL1978
Therapeutic Target	Hydrolase	ACHE	Acetylcholinesterase	P22303	CHEMBL220
Therapeutic Target	Lyase	CA12	Carbonic anhydrase XII	O43570	CHEMBL3242
Therapeutic Target	Lyase	CA4	Carbonic anhydrase IV	P22748	CHEMBL3729
Therapeutic Target	Lyase	CA7	Carbonic anhydrase VII	P43166	CHEMBL2326
Therapeutic Target	Nuclear hormone receptor subfamily 1	NR1H4	Bile acid receptor FXR	Q96RI1	CHEMBL2047
Therapeutic Target	Nuclear hormone receptor subfamily 3	ESR2	Estrogen receptor beta	Q92731	CHEMBL242
Therapeutic Target	Oxidoreductase	HSD17B1	Estradiol 17-beta-dehydrogenase 1	P14061	CHEMBL3181
Therapeutic Target	Protein Kinase	MKNK2	MAP kinase signal-integrating kinase 2	Q9HBH9	CHEMBL4204
Therapeutic Target	Protein Kinase	CSNK2A1	Casein kinase II alpha	P68400	CHEMBL3629
Therapeutic Target	Secreted protein	THPO	Thrombopoietin	P40225	CHEMBL1293256
Therapeutic Target	Secreted protein	TTR	Transthyretin	P02766	CHEMBL3194
Therapeutic Target	Serine protease	DPP4	Dipeptidyl peptidase IV	P27487	CHEMBL284

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials
NP level	7

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT04733651	Study to Investigate the Clinical Efficacy of Isoquercetin in Patients With COVID-19	COVID-19	Isoquercetin (NPC179950)	NP level
NCT04622865	Masitinib Combined With Isoquercetin and Best Supportive Care in Hospitalized Patients With Moderate and Severe COVID-19	COVID-19	Isoquercetin (NPC179950)	NP level
NCT04474626	Isoquercetin in Sickle Cell Anemia	sickle cell anemia	Isoquercetin (NPC179950)	NP level
NCT04536090	Study of Isoquercetin (IQC-950AN) Plus Standard of Care Versus Standard of Care Only for the Treatment of COVID-19	COVID-19	Isoquercetin (NPC179950)	NP level
NCT02552888	Nitrite, Isoquercetin and Endothelial Dysfunction (NICE) Trial	chronic kidney disease	Isoquercetin (NPC179950)	NP level
NCT02446795	Isoquercetin as an Adjunct Therapy in Patients With Kidney Cancer Receiving First-line Sunitinib: a Phase I/II Trial	renal cell carcinoma	Isoquercetin (NPC179950)	NP level
NCT04514510	Fixed Dose Flavonoid Isoquercetin on Thrombo-Inflammatory Biomarkers in Subjects With Stable Sickle Cell Disease	sickle cell anemia	Isoquercetin (NPC179950)	NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Diffuse large B-cell lymphomas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	THPO,CSNK2A1,ESR2,KDM1A,ACHE,CA12,PSMB5,CSNK2A2
Solid tumour/cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00-2F9Z	CA4,CA12,MKNK2,XDH,CSNK2A1,KDM1A,CA2
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	XDH,CA7,DPP4,KDM1A,CYP19A1,PSMB5,CA2
Serous cystadenoma,borderline malignancy of ovary Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73.4	CSNK2A3,XDH,CSNK2A1,CYP1A2,CA12,PSMB5,CA2
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	CYP1B1,CA7,XDH,TTR,DPP4,ACHE,CA2
Breast cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C60-2C6Y	CA4,CYP19A1,MKNK2,CA12,CA2,ESR2
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	THPO,CA7,XDH,TTR,ACHE,CA12
Glioblastoma of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.00	CYP1B1,CSNK2A3,DPP4,CYP19A1,CA12,CA2
Germ cell tumour of testis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80.2	XDH,CA4,TTR,DPP4,ACHE,CA12
Pheochromocytoma Disease Category: X.Extension Codes Disease ICD-11 Code: XH3854	XDH,CA4,TTR,ACHE,CA2
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	CA7,XDH,DPP4,CA12,CSNK2A2
Hepatocellular carcinoma of liver Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.02	CA12,CA4,CYP19A1,CA12,CYP19A1
Superficial ovarian endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10.B4	CA4,DPP4,ACHE,HSD17B1,CA2
Cytomegaloviral disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D82	THPO,ESR2,CYP1A1,ACHE,CA2
Malignant neoplasms of thyroid gland, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D10.Z	CYP1B1,CA7,XDH,DPP4,CA12
Renal cell carcinoma, chromophobe type Disease Category: X.Extension Codes Disease ICD-11 Code: XH6153	CYP1A2,TTR,CYP1A1,CA12,CA2
Malignant neoplasms of adrenal gland Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D11	CA7,CA4,DPP4,CYP19A1,CA12
Malignant neoplasms of biliary tract, distal bile duct Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C15	CSNK2A3,CSNK2A1,ESR2,CA4
Squamous cell carcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.2	CA7,XDH,CA12,HSD17B1
Urothelial carcinoma of bladder Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C94.2	HSD17B1,CYP1A2,CA2,TTR
Malignant neoplasms of thymus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C27	CYP1B1,ACHE,DPP4,PSMB5
Seborrhoeic dermatitis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA81	CA4,CA2,CA12
Glaucoma Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9C61	CA4,CA2,ACHE
Bacterial infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1A00-1C4Z	CA4,CA2,CA12
COVID-19 Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D6Y	NCT04536090,NCT04733651,NCT04622865
Hepatoblastoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.01	CA4,CYP19A1,CA12
Other specified malignant neoplasms of kidney, except renal pelvis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90.Y	XDH,ACHE,CYP19A1
West Nile virus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D46	DPP4,CYP19A1,ACHE
Other specified malignant neoplasms of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.Y	XDH,CA12,HSD17B1
Malignant neoplasms of corpus uteri, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.Z	XDH,CYP1A1,CA2
Carpal tunnel syndrome Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C10.0	CYP1B1,THPO,DPP4
Malignant haematopoietic neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B33	DPP4,KDM1A
Alzheimer disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A20	ESR2,ACHE
Mature T-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A90	KDM1A,MKNK2
Myocardial infarction Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA41-BA43	DPP4,THPO
Cushing syndrome Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A70	ESR2,CYP19A1
Heart failure Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD10-BD1Z	XDH,CA2
Chronic kidney disease Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GB61	XDH NCT02552888
Liver cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12	CSNK2A1,MKNK2
Sickle-cell disorder Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3A51	NCT04514510,NCT04474626
Systemic lupus erythematosus Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A40.0	ACHE,CYP1A1
Chikungunya virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D40	XDH,CYP19A1
Invasive carcinoma of breast Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C61	THPO,CA12
Lung cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25	KDM1A
Oesophagitis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA24	CYP19A1
Pediculosis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1G00	ACHE
Mild neurocognitive disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6D71	ACHE
Vasomotor/allergic rhinitis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA08	ESR2
Acute diabete complication Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A2Y	DPP4
Menopausal disorder Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA30	ESR2
Substance abuse Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6C40	ACHE
Autism spectrum disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A02	DPP4
Prostate hyperplasia Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA90	ESR2
Metabolic disorder Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C50-5D2Z	DPP4
Diabetes mellitus, type unspecified Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A14	DPP4
Acute myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A60	KDM1A
Influenza Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1E30-1E32	XDH
Mineral deficiency Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5B5K	XDH
Type 2 diabetes mellitus Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A11	DPP4
Asthma Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA23	CA4
Neuropathy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C0Z	CYP19A1
Inborn purine/pyrimidine/nucleotide metabolism error Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C55	XDH
Rheumatoid arthritis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA20	CA2
Parasitic worm infestation Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F90	ACHE
Myasthenia gravis Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C6Y	ACHE
Parkinsonism Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A00	ACHE
Essential hypertension Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA00	CA2
Hepatitis virus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1E50-1E51	ESR2
Chronic arterial occlusive disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD4Z	DPP4
Pain, unspecified Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG3Z	ACHE
Duodenal ulcer Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA63	CA2
Endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10	CYP19A1
Ischaemic/haemorrhagic stroke Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B20	THPO
Indeterminate colitis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD72	ESR2
Dementia Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6D80-6D8Z	ACHE
Psoriasis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA90	DPP4
Ewing sarcoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B52	KDM1A
Unspecific substance harmful effect Disease Category: 22.Injury, poisoning or certain other consequences of external causes Disease ICD-11 Code: NE6Z	ACHE
Encephalopathy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8E47	XDH
Myeloproliferative neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A20	KDM1A
Myelodysplastic syndrome Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A37	KDM1A
Colorectal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B91	MKNK2
Coronavirus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D92	CSNK2A1
Prostate cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C82	ESR2
Oesophageal/gastroduodenal disorder Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD90	ACHE
Amyloidosis Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5D00	TTR
Insomnia Disease Category: 07.Sleep-wake disorders Disease ICD-11 Code: 7A00-7A0Z	CA2
Cardiomyopathy Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BC43	TTR
Gout Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA25	XDH
Low bone mass disorder Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FB83	CA2
Sepsis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1G40-1G41	ESR2
Hyper-lipoproteinaemia Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C80	ESR2
Renal cell carcinoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90	NCT02446795
Coeliac disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA95	CYP1A1
Zika virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D48	ACHE
Osteoarthritis, unspecified Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA0Z	CA12
Leishmaniasis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F54	DPP4
Adenocarcinoma of stomach Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72.0	CYP19A1
Atrial fibrillation Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BC81.3	CA7
Myotonic dystrophy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C71.0	CYP1A1
Keratoconus Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9A78.50	CA4
Pre-eclampsia Disease Category: 18.Pregnancy, childbirth or the puerperium Disease ICD-11 Code: JA24	CA4
Tetralogy of Fallot Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LA88.2	CA4
Other specified malignant neoplasms ofcolon Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B90.Y	CYP1A1
Melanoma of skin Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C30	TTR
Pneumonia due to Pseudomonasaeruginosa Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA40.05	DPP4
Malignant neoplasms of oesophagus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B70	ACHE
Adenocarcinoma of prostate Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C82.0	TTR
Chronic rhinosinusitis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA0A	CYP1A1
Heart failure, unspecified Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD1Z	CYP1B1
Ebola virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D60.01	ACHE

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Vitex Agnus-Castus

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

Country/Region:

Traditional Medicine System:

Medicinal Functions:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

38 All known Ingredients in Total

24 Ingredients with Acceptable Bioavailablity

20 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Diffuse large B-cell lymphomas

Solid tumour/cancer

Carcinosarcoma of uterus

Serous cystadenoma,borderline malignancy of ovary

Adenocarcinoma of pancreas

Breast cancer

Adenocarcinoma of bronchus or lung

Glioblastoma of brain

Germ cell tumour of testis

Pheochromocytoma

Mesothelioma of pleura

Hepatocellular carcinoma of liver

Superficial ovarian endometriosis

Cytomegaloviral disease

Malignant neoplasms of thyroid gland, unspecified

Renal cell carcinoma, chromophobe type

Malignant neoplasms of adrenal gland

Malignant neoplasms of biliary tract, distal bile duct

Squamous cell carcinoma of bronchus or lung

Urothelial carcinoma of bladder

Malignant neoplasms of thymus

Seborrhoeic dermatitis

Glaucoma

Bacterial infection

COVID-19

Hepatoblastoma

Other specified malignant neoplasms of kidney, except renal pelvis

West Nile virus infection

Other specified malignant neoplasms of bronchus or lung

Malignant neoplasms of corpus uteri, unspecified

Carpal tunnel syndrome

Malignant haematopoietic neoplasm

Alzheimer disease

Mature T-cell lymphoma

Myocardial infarction

Cushing syndrome

Heart failure

Chronic kidney disease

Liver cancer

Sickle-cell disorder

Systemic lupus erythematosus

Chikungunya virus disease

Invasive carcinoma of breast

Lung cancer

Oesophagitis

Pediculosis

Mild neurocognitive disorder

Vasomotor/allergic rhinitis

Acute diabete complication

Menopausal disorder

Substance abuse

Autism spectrum disorder

Prostate hyperplasia

Metabolic disorder

Diabetes mellitus, type unspecified

Acute myeloid leukaemia

Influenza

Mineral deficiency

Type 2 diabetes mellitus

Asthma

Neuropathy