CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Helianthus Annuus

Example Image

PLANiTS DNA barcode

ATCACGTCGCCCCCACCAGGCATCCCYTATAGGGCTGTCTTGTGTTGGGGCGGAGATTGGTCTCCCGTGCCCATGGCGTGGTTGGCCTAAATAGGAGTCTCCTCRCGAGGGACGCACGGCTAGTGGTGGTTGATAAGACAGTCGTCTCGTGTCGTGCGTTTACTTTCTTGAGRGTAGATGCTCTTAAAGTACCCTGATGTGTTGTCTTATGACGATGCTTCGA

Taxonomic Information

Plant ID: NPO454
Plant Latin Name: Helianthus Annuus
Taxonomy Genus: Helianthus
Taxonomy Family: Asteraceae

Plant External Links:

NCBI TaxonomyDB: 4232
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:

Indonesia; India; China; Chile; Thailand; Argentina

Traditional Medicine System:

Unani; TCM; Homeopathy; Ayurveda; Siddha

Medicinal Functions:

Antipsoriatic; Antirheumatic; Diuretic; Expectorant; Febrifuge; Stomachic

Geographical Distribution

Indonesia; India; China; Chile; Thailand; Argentina

Geographical Distribution

−

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

148 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

92 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

80 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC97444

Ingredient ID: NPC96117

Ingredient ID: NPC94319

Ingredient ID: NPC94167

Ingredient ID: NPC93888

Ingredient ID: NPC92437

Ingredient ID: NPC85813

Ingredient ID: NPC81775

Ingredient ID: NPC8118

Ingredient ID: NPC81010

Ingredient ID: NPC73813

Ingredient ID: NPC70946

Ingredient ID: NPC68441

Ingredient ID: NPC62045

Ingredient ID: NPC60977

Ingredient ID: NPC59650

Ingredient ID: NPC57484

Ingredient ID: NPC55412

Ingredient ID: NPC50063

Ingredient ID: NPC491304

Ingredient ID: NPC490334

Ingredient ID: NPC490321

Ingredient ID: NPC490288

Ingredient ID: NPC490217

Ingredient ID: NPC490212

Ingredient ID: NPC490133

Ingredient ID: NPC490132

Ingredient ID: NPC490131

Ingredient ID: NPC490089

Ingredient ID: NPC489975

Ingredient ID: NPC489972

Ingredient ID: NPC489971

Ingredient ID: NPC489928

Ingredient ID: NPC489909

Ingredient ID: NPC489908

Ingredient ID: NPC489907

Ingredient ID: NPC489904

Ingredient ID: NPC489903

Ingredient ID: NPC489899

Ingredient ID: NPC489882

Ingredient ID: NPC488363

Ingredient ID: NPC48623

Ingredient ID: NPC473452

Ingredient ID: NPC470876

Ingredient ID: NPC45960

Ingredient ID: NPC424

Ingredient ID: NPC36061

Ingredient ID: NPC33394

Ingredient ID: NPC330659

Ingredient ID: NPC328760

Ingredient ID: NPC328447

Ingredient ID: NPC325617

Ingredient ID: NPC317120

Ingredient ID: NPC316929

Ingredient ID: NPC301585

Ingredient ID: NPC300606

Ingredient ID: NPC300326

Ingredient ID: NPC296256

Ingredient ID: NPC295644

Ingredient ID: NPC294902

Ingredient ID: NPC294548

Ingredient ID: NPC290319

Ingredient ID: NPC289870

Ingredient ID: NPC28657

Ingredient ID: NPC286457

Ingredient ID: NPC283790

Ingredient ID: NPC281686

Ingredient ID: NPC280749

Ingredient ID: NPC279241

Ingredient ID: NPC279026

Ingredient ID: NPC278068

Ingredient ID: NPC277205

Ingredient ID: NPC277054

Ingredient ID: NPC274327

Ingredient ID: NPC272614

Ingredient ID: NPC269980

Ingredient ID: NPC269919

Ingredient ID: NPC268129

Ingredient ID: NPC265305

Ingredient ID: NPC261831

Ingredient ID: NPC261379

Ingredient ID: NPC259631

Ingredient ID: NPC254482

Ingredient ID: NPC249797

Ingredient ID: NPC242580

Ingredient ID: NPC23962

Ingredient ID: NPC237812

Ingredient ID: NPC235027

Ingredient ID: NPC232512

Ingredient ID: NPC230301

Ingredient ID: NPC228451

Ingredient ID: NPC226453

Ingredient ID: NPC224651

Ingredient ID: NPC222781

Ingredient ID: NPC216630

Ingredient ID: NPC209970

Ingredient ID: NPC209560

Ingredient ID: NPC208793

Ingredient ID: NPC20791

Ingredient ID: NPC206889

Ingredient ID: NPC206807

Ingredient ID: NPC203719

Ingredient ID: NPC203468

Ingredient ID: NPC200324

Ingredient ID: NPC19074

Ingredient ID: NPC189436

Ingredient ID: NPC187770

Ingredient ID: NPC185755

Ingredient ID: NPC185488

Ingredient ID: NPC178533

Ingredient ID: NPC17810

Ingredient ID: NPC176309

Ingredient ID: NPC174246

Ingredient ID: NPC170861

Ingredient ID: NPC170666

Ingredient ID: NPC1682

Ingredient ID: NPC167400

Ingredient ID: NPC165967

Ingredient ID: NPC164706

Ingredient ID: NPC162742

Ingredient ID: NPC158079

Ingredient ID: NPC156146

Ingredient ID: NPC155263

Ingredient ID: NPC15498

Ingredient ID: NPC154186

Ingredient ID: NPC152451

Ingredient ID: NPC150950

Ingredient ID: NPC149803

Ingredient ID: NPC149184

Ingredient ID: NPC147983

Ingredient ID: NPC142860

Ingredient ID: NPC138109

Ingredient ID: NPC137958

Ingredient ID: NPC136014

Ingredient ID: NPC130683

Ingredient ID: NPC130459

Ingredient ID: NPC128410

Ingredient ID: NPC127223

Ingredient ID: NPC126681

Ingredient ID: NPC123522

Ingredient ID: NPC120649

Ingredient ID: NPC11996

Ingredient ID: NPC117572

Ingredient ID: NPC11648

Ingredient ID: NPC11433

Ingredient ID: NPC113733

Ingredient ID: NPC112890

Ingredient ID: NPC104137

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Show entries

Search:

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Cytochrome P450	Cytochrome P450 family 1	CYP1A2	Cytochrome P450 1A2	P05177	CHEMBL3356
Cytochrome P450	Cytochrome P450 family 2	CYP2C9	Cytochrome P450 2C9	P11712	CHEMBL3397
Cytochrome P450	Cytochrome P450 family 2	CYP2D6	Cytochrome P450 2D6	P10635	CHEMBL289
Cytochrome P450	Cytochrome P450 family 3	CYP3A4	Cytochrome P450 3A4	P08684	CHEMBL340
Drug Transporter	SLC superfamily of solute carriers	SLCO1B1	Solute carrier organic anion transporter family member 1B1	Q9Y6L6	CHEMBL1697668
Therapeutic Target	Enzyme	NOX4	NADPH oxidase 4	Q9NPH5	CHEMBL1250375
Therapeutic Target	Enzyme	AKR1C3	Aldo-keto-reductase family 1 member C3	P42330	CHEMBL4681
Therapeutic Target	Enzyme	POLB	DNA polymerase beta	P06746	CHEMBL2392
Therapeutic Target	Enzyme	ALOX12	Arachidonate 12-lipoxygenase	P18054	CHEMBL3687
Therapeutic Target	Fatty acid binding protein family	FABP4	Fatty acid binding protein adipocyte	P15090	CHEMBL2083

Showing 1 to 10 of 50 entries

Previous1 2 3 4 5Next

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials
NP level	622

Clinical trial details

Show entries

Search:

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT00000114	Randomized Trial of Vitamin A and Vitamin E Supplementation for Retinitis Pigmentosa	retinitis pigmentosa	Retinol (NPC55412)	NP level
NCT00000116	Randomized Trial of DHA for Retinitis Pigmentosa Patients Receiving Vitamin A	retinitis pigmentosa	Retinol (NPC55412)	NP level
NCT00000152	Randomized Trial of Beta-Carotene and Macular Degeneration	macular degeneration	Beta Carotene (NPC17810)	NP level
NCT00000161	Randomized Trials of Vitamin Supplements and Eye Disease	cataract;macular degeneration	Beta Carotene (NPC17810);Ascorbate (NPC187770)	NP level
NCT00000324	Tryptophan and Behavior Therapy for Cocaine Abuse - 1	cocaine dependence	Tryptophan (NPC203468)	NP level
NCT00000372	Glycine and D-Cycloserine in Schizophrenia	schizophrenia	Glycine (NPC126681)	NP level
NCT00000461	Harvard Atherosclerosis Reversibility Project (HARP)	Myocardial Ischemia	Niacin (NPC167400)	NP level
NCT00000482	Coronary Drug Project	Myocardial Ischemia;myocardial infarction	Niacin (NPC167400)	NP level
NCT00000512	Familial Atherosclerosis Treatment Study	Myocardial Ischemia	Niacin (NPC167400)	NP level
NCT00000541	Women's Antioxidant and Folic Acid Cardiovascular Study (WAFACS)	Myocardial Ischemia	Ascorbate (NPC187770)	NP level

Showing 1 to 10 of 622 entries

Previous1 2 3 4 5…63Next

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Show entries

Search:

Associated Disease of the Plant	Association Type & Detailed Evidence
Abdominal pelvic pain Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MD81	NCT00694564
Abortion Disease Category: 18.Pregnancy, childbirth or the puerperium Disease ICD-11 Code: JA00	DRD1
Acne vulgaris Disease Category: 14.Diseases of the skin Disease ICD-11 Code: ED80	MMP2 NCT03090048,NCT03522922
Acute diabete complication Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A2Y	KDR,AKR1B1,FFAR1,PPARA,AURKB
Acute ischaemic heart disease, unspecified Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA4Z	NCT00855257
Acute myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A60	AXL,SRC,BCL2,MCL1,FLT3,TP53,AURKB,NFKB1,PIM1 NCT01842139,NCT00329498,NCT00184054
Acute myocardial infarction Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA41	NCT02929888
Acute promyelocytic leukaemia Disease Category: X.Extension Codes Disease ICD-11 Code: XH1A50	NCT03624270
Acute respiratory distress syndrome Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CB00	NCT04404387,NCT03718507
Acute viral hepatitis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1E50	NCT00108589

Showing 1 to 10 of 420 entries

Previous1 2 3 4 5…42Next

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Helianthus Annuus

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

Country/Region:

Traditional Medicine System:

Medicinal Functions:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

148 All known Ingredients in Total

92 Ingredients with Acceptable Bioavailablity

80 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Abdominal pelvic pain

Abortion

Acne vulgaris

Acute diabete complication

Acute ischaemic heart disease, unspecified

Acute myeloid leukaemia

Acute myocardial infarction

Acute promyelocytic leukaemia

Acute respiratory distress syndrome

Acute viral hepatitis

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

>> Targets derived from weak experimental activities