• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Ilex Purpurea


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

NA

Click for details-----ITS2

ATCACGTCACCCCAACCCTAATGCCTAGTAGGATATTGTAGGAGTTGGGGCTGAAATTGGCCTCCCATCCACGACAATGCACGGTTGGCCCACAAAATGAGTTCTTAACGATGGACGTTAAGACAAGTGGTGGTTGAAAGACCTCTTACATCATGTTATGATGCACTAAGTCTGTAGTGAACTCCGACCATAACCCTGTGTTCCTTCTTCAACAATGGTGCTTCGA
Taxonomic Information

Plant ID: NPO28212
Plant Latin Name: Ilex Purpurea
Taxonomy Genus: Ilex
Taxonomy Family: Aquifoliaceae

Plant External Links:

NCBI TaxonomyDB: 185544
Plant-of-the-World-Online: n.a.

Used in Medicines

Unknown.

Geographical Distribution
Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

15 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


6 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

12 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC294548

Ingredient ID: NPC286245

Ingredient ID: NPC261831

Ingredient ID: NPC256849

Ingredient ID: NPC255837

Ingredient ID: NPC250436

Ingredient ID: NPC244690

Ingredient ID: NPC219876

Ingredient ID: NPC176740

Ingredient ID: NPC173637

Ingredient ID: NPC167983

Ingredient ID: NPC160512

Ingredient ID: NPC126029

Ingredient ID: NPC119133

Ingredient ID: NPC102281