• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Daphniphyllum Macropodum


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAACCTGCCAAGCAGAACGACCGGCGAACCCGTAACAATGTTTTTGGGGGGTGAAGGGGGGTGCGAGCCCCGTTTCCTCCCCCATGTCGAGGCACGCTCGGCCCAACATTTGTGCCGGCGTGCTCTCGTCCTCACAACCAACCCCCGGCGCAAACCGCGTCAAGGAAAGTCTAATGCAAGAGCATATGCTTCGTTCGTGGGCCCTGTCTCGGGGTCTGCGGGGAGGGGGCAGTGTCTTCTTTGATACCATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATTGCATTTGCCCCCACAACCCCTGCCTAGAATAATGGTGCAGGTCCGTTGAGGGGGGGTGGAGATTGGCCTCCCGTGCACACTCTGTTGCGGTTGGCCCAAAAGCGGAGCCCCGTGCGATGGCGTAAGTCACGGCAAGTGGTGGTTAAACAGGCCTTGGCCTTAGCAGGATCGTGCCGTGTGCTGCCCATCGTTCGCGGGAGCTAATGAGACCCCATTGTGTCGTTCCAACGATGCTTCCATTGCGACCCCA

Click for details-----ITS1

NA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO25184
Plant Latin Name: Daphniphyllum Macropodum
Taxonomy Genus: Daphniphyllum
Taxonomy Family: Daphniphyllaceae

Plant External Links:

NCBI TaxonomyDB: 276776
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

29 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


27 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

20 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC88190

Ingredient ID: NPC53069

Ingredient ID: NPC476952

Ingredient ID: NPC476951

Ingredient ID: NPC473337

Ingredient ID: NPC473295

Ingredient ID: NPC471109

Ingredient ID: NPC470540

Ingredient ID: NPC470539

Ingredient ID: NPC470538

Ingredient ID: NPC470537

Ingredient ID: NPC470536

Ingredient ID: NPC470535

Ingredient ID: NPC470534

Ingredient ID: NPC470533

Ingredient ID: NPC470532

Ingredient ID: NPC470531

Ingredient ID: NPC470530

Ingredient ID: NPC470529

Ingredient ID: NPC470528

Ingredient ID: NPC470527

Ingredient ID: NPC36147

Ingredient ID: NPC280903

Ingredient ID: NPC275651

Ingredient ID: NPC262702

Ingredient ID: NPC248143

Ingredient ID: NPC23288

Ingredient ID: NPC173543

Ingredient ID: NPC102223

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM
Target Type: Individual Protein of Homo sapiens
*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.
.

Detailed Information of Target Proteins

Target Type Protein Class Gene ID Protein Name Uniprot ID Target ChEMBL ID
Cytochrome P450 Cytochrome P450 family 1 CYP1B1 Cytochrome P450 1B1 Q16678 CHEMBL4878
Therapeutic Target Hydrolase ACHE Acetylcholinesterase P22303 CHEMBL220
Clinical Trials Summary
Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type Number of clinical trials
NP level10
Clinical trial details
NCT ID Title Condition Form in clinical use Associated by plant or compound
NCT02861261 A Study on the Efficacy and Gut Microbiota of Berberine and Probiotics in Patients With Newly Diagnosed Type 2 Diabetes type 2 diabetes mellitus Berberine (NPC53069) NP level
NCT02084004 Effects of Berberine Hydrochloride and Bifidobacterium in Diabetes Mellitus Prevention and Treatment type 2 diabetes mellitus Berberine (NPC53069) NP level
NCT02226185 Study of Berberine Hydrochloride in Prevention of Colorectal Adenomas Recurrence colorectal adenoma Berberine (NPC53069) NP level
NCT00425009 Therapeutic Effects of Berberine in Patients With Type 2 Diabetes type 2 diabetes mellitus Berberine (NPC53069) NP level
NCT02082756 Effects of Berberine Hydrochloride and Bifidobacterium in Prediabetes Prevention and Treatment prediabetes syndrome Berberine (NPC53069) NP level
NCT03281096 A Research of Berberine Hydrochloride to Prevent Colorectal Adenomas in Patients With Previous Colorectal Cancer colorectal adenoma Berberine (NPC53069) NP level
NCT03486496 Gefitinib and Berberine in the First-line Treatment of Lung Adenocarcinoma With EGFR Mutation lung adenocarcinoma Berberine (NPC53069) NP level
NCT00633282 Role of Pioglitazone and Berberine in Treatment of Non-Alcoholic Fatty Liver Disease non-alcoholic fatty liver disease Berberine (NPC53069) NP level
NCT02548832 Bezafibrate Plus Berberine in Mixed Dyslipidemia Combined hyperlipidemia Berberine (NPC53069) NP level
NCT03333265 Primary Chemoprevention of Familial Adenomatous Polyposis With Berberine Hydrochloride colorectal adenoma Berberine (NPC53069) NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

 How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant
Association Type & Detailed Evidence
Colorectal cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B91
 NCT03333265,NCT02226185,NCT03281096
Type 2 diabetes mellitus
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A11
 NCT00425009,NCT02084004,NCT02861261
Adenocarcinoma of pancreas
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C10.0
 ACHE,CYP1B1
Malignant neoplasms of thymus
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C27
 ACHE,CYP1B1
Pediculosis
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1G00
 ACHE
Mild neurocognitive disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6D71
 ACHE
Pain, unspecified
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MG3Z
 ACHE
Alzheimer disease
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A20
 ACHE
Substance abuse
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6C40
 ACHE
Glaucoma
Disease Category: 09.Diseases of the visual system
Disease ICD-11 Code: 9C61
 ACHE
Dementia
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6D80-6D8Z
 ACHE
Myasthenia gravis
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C6Y
 ACHE
Parasitic worm infestation
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1F90
 ACHE
Oesophageal/gastroduodenal disorder
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DD90
 ACHE
Unspecific substance harmful effect
Disease Category: 22.Injury, poisoning or certain other consequences of external causes
Disease ICD-11 Code: NE6Z
 ACHE
Parkinsonism
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A00
 ACHE
Mixed hyperlipidaemia
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5C80.2
 NCT02548832
Non-alcoholic fatty liver disease
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DB92
 NCT00633282
Adenocarcinoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D40
 NCT03486496
Intermediate hyperglycaemia, unspecified
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A40.Z
 NCT02082756
Pheochromocytoma
Disease Category: X.Extension Codes
Disease ICD-11 Code: XH3854
 ACHE
Zika virus disease
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D48
 ACHE
Diffuse large B-cell lymphomas
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A81
 ACHE
Other specified malignant neoplasms of kidney, except renal pelvis
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C90.Y
 ACHE
West Nile virus infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D46
 ACHE
Superficial ovarian endometriosis
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA10.B4
 ACHE
Malignant neoplasms of oesophagus
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B70
 ACHE
Cytomegaloviral disease
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D82
 ACHE
Systemic lupus erythematosus
Disease Category: 04.Diseases of the immune system
Disease ICD-11 Code: 4A40.0
 ACHE
Malignant neoplasms of thyroid gland, unspecified
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D10.Z
 CYP1B1
Adenocarcinoma of bronchus or lung
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25.0
 ACHE
Heart failure, unspecified
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BD1Z
 CYP1B1
Glioblastoma of brain
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00.00
 CYP1B1
Germ cell tumour of testis
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C80.2
 ACHE
Carpal tunnel syndrome
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C10.0
 CYP1B1
Ebola virus disease
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D60.01
 ACHE

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network 
Data Section
Select to Download
1. General Info & Plant Usage & Geographical Distribution  
2. Plant Ingredients  
3. Collective Molecular Proteins  
4. Collective Enriched Activities  
5. Plant molecular targets overlapping with DEGs  
6. Associated clinical trials  
7. Associated Human Diseases  
>> Targets derived from weak experimental activities
About Us

The CMAUP database is developed by the Bioinformatics & Drug Design group (BIDD) and School of Pharmacy, Fudan University.

CMAUP

Home

About

Browse

Help

Useful links

BIDD home

NPASS database

TCM-ID database

TTD database

Contact

826 Zhangheng Road, Pudong New District, Shanghai, China

Principle Investigator:
Prof. Chen Yu Zong
chenyuzong@sz.tsinghua.edu.cn
Prof. Zeng Xian
zengxian@fudan.edu.cn

Developer & Maintainer:
Ph.D. Student Dongyue Hou
dyhou22@m.fudan.edu.cn
Mr. Hanbo Lin
hblin19@fudan.edu.cn
Ms. Yuhan Feng
yhfeng22@m.fudan.edu.cn

© 2023 Copyright: Bioinformatics & Drug Design group