CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Anthocleista Grandiflora

Example Image

PLANiTS DNA barcode

Click for details-----ITS

TCGAATCCTGCGAAGCAGACGACCCGCGAACTTGTTTAACCCACGGGCGCCGGGACGTTGGGAACCGCGGACCGGCGCCCCGCGCANGGCGTCNANCTCCGGTCNCTCGCCGGGCNAAAAACTAAACCGGGGCGCNGAAANGCCCCNAGGAAAACGAGAAAAGGATGGCCCGCCTCCCGACGCCCCGTACGCGGGGCGCGCGGGGGGAACACGGGCCCCTGTAGAAACTGGTACGACTGTCGGCAACGGATATCTCGGCTCCCGCATCGATGAAGAACGTAGCGAACTGCGATACTTGGTGTGAACTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATCCGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCCCCCCCCCCAACCCCGTGCACCTCCGTCGGTCGCGGGGGGGACTGAAAGGGGGGGCGGAAGATGGCTTCCCGTGCCCCTGGCGCGGCTGGCCTAAATACGAGTCCCTTGCGACGGACGCGACGACAAGTGGTGGTTGAATGCCTCAACTCGGGCGCTGTCGCGCGAGGCCCCGTCGGGAGAGGAGACTGCCCCGACCCTGTAAGCGTGCGTCGCCGTGACGCGTGCCACGACCGCGACCCCAGGTCAGGCG

Click for details-----ITS1

TCGAATCCTGCGAAGCAGACGACCCGCGAACTTGTTTAACCCACGGGCGCCGGGACGTGGGGAACCGCGGACCGGCGCCCCGCGCACGGCGTCGATCTCYGGTCGCTCGCCGGGCGAGAAACTAAACCGGGGCGCGGAAAGGCGCCAAGGAAAACGAGAAAAGGATGGCCCGCCTCCCGACGCCCCGTACGCGGGGCGCGCGGGGGGAGCACGGGCGCCTGTAGAAACTGATA

Click for details-----ITS2

ATCGCGTCCCCCCCCCCAACCCCGTGCACCTCCGTCGGTCGCGGGGGGGACTGAAAGGGGGGGCGGAAGATGGCTTCCCGTGCCCCTGGCGCGGCTGGCCTAAATACGAGTCCCTTGCGACGGACGCGACGACAAGTGGTGGTTGAATGCCTCAACTCGGGCGCTGTCGCGCGAGGCCCCGTCGGGAGAGGAGACTGCCCCGACCCTGTAAGCGTGCGTCGCCGTGACGCGTGCCACGACCGCGACCCCAGGTCAGGCG

Taxonomic Information

Plant ID: NPO23916
Plant Latin Name: Anthocleista Grandiflora
Taxonomy Genus: Anthocleista
Taxonomy Family: Gentianaceae

Plant External Links:

NCBI TaxonomyDB: 28539
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:

South Africa

Traditional Medicine System:

Geographical Distribution

South Africa

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

9 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

7 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

7 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC32298

Ingredient ID: NPC233282

Ingredient ID: NPC22783

Ingredient ID: NPC197425

Ingredient ID: NPC193805

Ingredient ID: NPC144394

Ingredient ID: NPC128216

Ingredient ID: NPC121560

Ingredient ID: NPC118343

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Cytochrome P450	Cytochrome P450 family 1	CYP1B1	Cytochrome P450 1B1	Q16678	CHEMBL4878
Cytochrome P450	Cytochrome P450 family 1	CYP1A2	Cytochrome P450 1A2	P05177	CHEMBL3356
Therapeutic Target	Enzyme	AKR1C3	Aldo-keto-reductase family 1 member C3	P42330	CHEMBL4681
Therapeutic Target	Nuclear hormone receptor subfamily 3	AR	Androgen Receptor	P10275	CHEMBL1871
Therapeutic Target	Serine protease	DPP4	Dipeptidyl peptidase IV	P27487	CHEMBL284
Therapeutic Target	Transcription factor	TP53	Cellular tumor antigen p53	P04637	CHEMBL4096
Therapeutic Target	Transferase	TNKS2	Tankyrase-2	Q9H2K2	CHEMBL6154
Therapeutic Target	Transferase	TNKS	Tankyrase-1	O95271	CHEMBL6164

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials
NP level	1

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT01015521	Efficacy Study of Aminoflavone Prodrug to Treat Breast Cancer	breast neoplasm	Flavone (NPC32298)	NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Ovarian cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73	TNKS,TNKS2,TP53
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	AKR1C3,CYP1B1,DPP4
Malignant neoplasms of thyroid gland, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D10.Z	CYP1B1,GABRA6,DPP4
Glioblastoma of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.00	AR,CYP1B1,DPP4
Prostate cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C82	AKR1C3,AR
Female pelvic pain Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA34	AKR1C3,AR
Acute myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A60	AR,TP53
Chronic arterial occlusive disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD4Z	DPP4,TP53
Malignant haematopoietic neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B33	DPP4,TP53
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	DPP4,TP53
Serous cystadenoma,borderline malignancy of ovary Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73.4	CYP1A2,TP53
Diffuse large B-cell lymphomas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	AR,TP53
Hepatocellular carcinoma of liver Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.02	AKR1C3,AKR1C3
Malignant neoplasms of thymus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C27	CYP1B1,DPP4
Carpal tunnel syndrome Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C10.0	CYP1B1,DPP4
Malignant neoplasms of adrenal gland Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D11	AR,DPP4
Solid tumour/cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00-2F9Z	TP53
Alcoholic liver disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB94	AR
Metabolic disorder Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C50-5D2Z	DPP4
Autism spectrum disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A02	DPP4
Brain cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00	TP53
Head and neck cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D42	TP53
Mammary tumour Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C60-2C6Z	AR
Breast cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C60-2C6Y	AR
Myelodysplastic syndrome Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A37	TP53
Prostate hyperplasia Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA90	AR
Liposarcoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B59	TP53
Alopecia Disease Category: 14.Diseases of the skin Disease ICD-11 Code: ED70	AR
Lip/oral cavity/pharynx neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B6E	TP53
Bladder cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C94	TP53
Metastatic liver/bile duct neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D80	TP53
Thrombosis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB61-GB90	AR
Psoriasis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA90	DPP4
Chronic kidney disease Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GB61	AR
Pancreatic cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10	TP53
Myocardial infarction Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA41-BA43	DPP4
Acute diabete complication Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A2Y	DPP4
Peritoneal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C51	TP53
Type 2 diabetes mellitus Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A11	DPP4
Muscular dystrophy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C70	AR
Transplant rejection Disease Category: 22.Injury, poisoning or certain other consequences of external causes Disease ICD-11 Code: NE84	TP53
Ovarian dysfunction Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A80	TP53
Cardiovascular disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA00-BE2Z	AR
Cervical cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C77	TP53
Colorectal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B91	TP53
Low bone mass disorder Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FB83	AR
Endometrial cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76	TP53
Acne vulgaris Disease Category: 14.Diseases of the skin Disease ICD-11 Code: ED80	AR
Mature B-cell leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A82	TP53
Muscle disorder Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FB32-FB3Z	AR
Chronic obstructive pulmonary disease Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA22	AR
Hypo-osmolality/hyponatraemia Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C72	AR
Esophageal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B70	TP53
Kidney failure Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GB60-GB6Z	TP53
Heart failure Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD10-BD1Z	AR
Fallopian tube cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C74	TP53
Pituitary gland disorder Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A60-5A61	AR
Stomach cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72	TP53
Diabetes mellitus, type unspecified Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A14	DPP4
Testicular dysfunction Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A81	AR
Neoplasms of unknown behaviour of breast Disease Category: 02.Neoplasms Disease ICD-11 Code: 2F95	NCT01015521
Malignant neoplasms of biliary tract, distal bile duct Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C15	TP53
Leishmaniasis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F54	DPP4
Malignant neoplasm metastasis in lymph nodes of head, face or neck Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D60.0	AKR1C3
Squamous cell carcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.2	AKR1C3
West Nile virus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D46	DPP4
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	DPP4
Pneumonia due to Pseudomonasaeruginosa Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA40.05	DPP4
Other specified malignant neoplasms of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.Y	AKR1C3
Superficial ovarian endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10.B4	DPP4
Urothelial carcinoma of bladder Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C94.2	CYP1A2
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	AKR1C3
Heart failure, unspecified Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD1Z	CYP1B1
Renal cell carcinoma, chromophobe type Disease Category: X.Extension Codes Disease ICD-11 Code: XH6153	CYP1A2
Germ cell tumour of testis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80.2	DPP4
Gliomas of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.0	AKR1C3

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Anthocleista Grandiflora

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

Country/Region:

Traditional Medicine System:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

9 All known Ingredients in Total

7 Ingredients with Acceptable Bioavailablity

7 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Ovarian cancer

Adenocarcinoma of pancreas

Malignant neoplasms of thyroid gland, unspecified

Glioblastoma of brain

Prostate cancer

Female pelvic pain

Acute myeloid leukaemia

Chronic arterial occlusive disease

Malignant haematopoietic neoplasm

Carcinosarcoma of uterus

Serous cystadenoma,borderline malignancy of ovary

Diffuse large B-cell lymphomas

Hepatocellular carcinoma of liver

Malignant neoplasms of thymus

Carpal tunnel syndrome

Malignant neoplasms of adrenal gland

Solid tumour/cancer

Alcoholic liver disease

Metabolic disorder

Autism spectrum disorder

Brain cancer

Head and neck cancer

Mammary tumour

Breast cancer

Myelodysplastic syndrome

Prostate hyperplasia

Liposarcoma

Alopecia

Lip/oral cavity/pharynx neoplasm

Bladder cancer

Metastatic liver/bile duct neoplasm

Thrombosis

Psoriasis

Chronic kidney disease

Pancreatic cancer

Myocardial infarction

Acute diabete complication

Peritoneal cancer

Type 2 diabetes mellitus

Muscular dystrophy

Transplant rejection

Ovarian dysfunction

Cardiovascular disease

Cervical cancer

Colorectal cancer

Low bone mass disorder

Endometrial cancer

Acne vulgaris

Mature B-cell leukaemia

Muscle disorder

Chronic obstructive pulmonary disease

Hypo-osmolality/hyponatraemia

Esophageal cancer

Kidney failure

Heart failure

Fallopian tube cancer

Pituitary gland disorder

Stomach cancer

Diabetes mellitus, type unspecified

Testicular dysfunction

Neoplasms of unknown behaviour of breast

Malignant neoplasms of biliary tract, distal bile duct