CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Senegalia Mellifera

Example Image

PLANiTS DNA barcode

TCGATGCCCCTCGAGAAGGCAGACCCGCGAACCCGTTCACGCATGGACCCGCGGCCGGGGAGGGCGACGGCGCGCCCGTGGCCCCCCCGGCGAACGAATCCCCGGCGCCCCAGGCGCCAAGGAGCACCGAAACTAGAGCGGGACCACGGCGGCCGGCGGCCCGGGTGCGGCGCCGGCCGGCCGCGCGTGCGTCACGCGTCCTGGCAGCAGTCCCAA

Click for details-----ITS2

AGCGTCGCCTCCGCCCCCTTCGGGGGGCGTCACGGCGGACGATGGCCTCCCGCGAGCGTCGCCTCCCGGTTGGCCGAAAGATGGGCCCGACGCGACGGCGGCCGCGATCCACGGTGGCTGAGCGAGCGCTCGAGACCGGACGCGCGCGCGCCCCCGCGCTTCACGCCCGCGCCCCGCTTCGGCGGGGCCGCCCGCCCTT

Taxonomic Information

Plant ID: NPO23853
Plant Latin Name: Senegalia Mellifera
Taxonomy Genus: Senegalia
Taxonomy Family: Fabaceae

Plant External Links:

NCBI TaxonomyDB: 381101
Plant-of-the-World-Online: 60453641-2

Used in Medicines

Country/Region:

Madagascar; Angola; South Africa; Tanzania; Zimbabwe; Rwanda; Swaziland; Kenya

Traditional Medicine System:

Geographical Distribution

Eritrea; Madagascar; Angola; Uganda; Chad; Pakistan; Egypt; Tanzania; South Africa; India; Saudi Arabia; Zimbabwe; Ethiopia; Djibouti; Rwanda; Namibia; Somalia; Swaziland; Kenya; Yemen; Sudan

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

84 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

43 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

22 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC97191

Ingredient ID: NPC95615

Ingredient ID: NPC95381

Ingredient ID: NPC90493

Ingredient ID: NPC88043

Ingredient ID: NPC87543

Ingredient ID: NPC85813

Ingredient ID: NPC73449

Ingredient ID: NPC62577

Ingredient ID: NPC58967

Ingredient ID: NPC55900

Ingredient ID: NPC50898

Ingredient ID: NPC49188

Ingredient ID: NPC41985

Ingredient ID: NPC38474

Ingredient ID: NPC3812

Ingredient ID: NPC34070

Ingredient ID: NPC33690

Ingredient ID: NPC311082

Ingredient ID: NPC307163

Ingredient ID: NPC306418

Ingredient ID: NPC302824

Ingredient ID: NPC301205

Ingredient ID: NPC300520

Ingredient ID: NPC294755

Ingredient ID: NPC294555

Ingredient ID: NPC294548

Ingredient ID: NPC291516

Ingredient ID: NPC288506

Ingredient ID: NPC28779

Ingredient ID: NPC279451

Ingredient ID: NPC279121

Ingredient ID: NPC272606

Ingredient ID: NPC268710

Ingredient ID: NPC266441

Ingredient ID: NPC265800

Ingredient ID: NPC262902

Ingredient ID: NPC260734

Ingredient ID: NPC25601

Ingredient ID: NPC249958

Ingredient ID: NPC247237

Ingredient ID: NPC244284

Ingredient ID: NPC244181

Ingredient ID: NPC239361

Ingredient ID: NPC237608

Ingredient ID: NPC236709

Ingredient ID: NPC227930

Ingredient ID: NPC217396

Ingredient ID: NPC217065

Ingredient ID: NPC21666

Ingredient ID: NPC206095

Ingredient ID: NPC204649

Ingredient ID: NPC189498

Ingredient ID: NPC189156

Ingredient ID: NPC185690

Ingredient ID: NPC184144

Ingredient ID: NPC181295

Ingredient ID: NPC181158

Ingredient ID: NPC177463

Ingredient ID: NPC177119

Ingredient ID: NPC176740

Ingredient ID: NPC175410

Ingredient ID: NPC169110

Ingredient ID: NPC161505

Ingredient ID: NPC154152

Ingredient ID: NPC152638

Ingredient ID: NPC145820

Ingredient ID: NPC140332

Ingredient ID: NPC139545

Ingredient ID: NPC134581

Ingredient ID: NPC133237

Ingredient ID: NPC129165

Ingredient ID: NPC129088

Ingredient ID: NPC125898

Ingredient ID: NPC123965

Ingredient ID: NPC119775

Ingredient ID: NPC118004

Ingredient ID: NPC116745

Ingredient ID: NPC115951

Ingredient ID: NPC112688

Ingredient ID: NPC108218

Ingredient ID: NPC107075

Ingredient ID: NPC10316

Ingredient ID: NPC101580

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Cytochrome P450	Cytochrome P450 family 1	CYP1A1	Cytochrome P450 1A1	P04798	CHEMBL2231
Cytochrome P450	Cytochrome P450 family 1	CYP1A2	Cytochrome P450 1A2	P05177	CHEMBL3356
Cytochrome P450	Cytochrome P450 family 1	CYP1B1	Cytochrome P450 1B1	Q16678	CHEMBL4878
Therapeutic Target	Enzyme	AKR1C3	Aldo-keto-reductase family 1 member C3	P42330	CHEMBL4681
Therapeutic Target	Enzyme	NOX4	NADPH oxidase 4	Q9NPH5	CHEMBL1250375
Therapeutic Target	Hydrolase	ACHE	Acetylcholinesterase	P22303	CHEMBL220
Therapeutic Target	Lyase	CA7	Carbonic anhydrase VII	P43166	CHEMBL2326
Therapeutic Target	Lyase	CA4	Carbonic anhydrase IV	P22748	CHEMBL3729
Therapeutic Target	Lyase	CA12	Carbonic anhydrase XII	O43570	CHEMBL3242
Therapeutic Target	Membrane receptor	APP	Beta amyloid A4 protein	P05067	CHEMBL2487
Therapeutic Target	Metallo protease	MMP12	Matrix metalloproteinase 12	P39900	CHEMBL4393
Therapeutic Target	Nuclear hormone receptor subfamily 3	ESR2	Estrogen receptor beta	Q92731	CHEMBL242
Therapeutic Target	Oxidoreductase	ALOX15	Arachidonate 15-lipoxygenase	P16050	CHEMBL2903
Therapeutic Target	Oxidoreductase	HSD17B1	Estradiol 17-beta-dehydrogenase 1	P14061	CHEMBL3181
Therapeutic Target	Protein Kinase	FLT3	Tyrosine-protein kinase receptor FLT3	P36888	CHEMBL1974
Therapeutic Target	Protein Kinase	MKNK1	MAP kinase-interacting serine/threonine-protein kinase MNK1	Q9BUB5	CHEMBL4718
Therapeutic Target	Protein Kinase	CSNK2A1	Casein kinase II alpha	P68400	CHEMBL3629
Therapeutic Target	Protein Kinase	MKNK2	MAP kinase signal-integrating kinase 2	Q9HBH9	CHEMBL4204
Therapeutic Target	Secreted protein	THPO	Thrombopoietin	P40225	CHEMBL1293256
Therapeutic Target	Secreted protein	TTR	Transthyretin	P02766	CHEMBL3194
Therapeutic Target	Serine protease	DPP4	Dipeptidyl peptidase IV	P27487	CHEMBL284
Therapeutic Target	Small molecule receptor (family A GPCR)	FFAR1	Free fatty acid receptor 1	O14842	CHEMBL4422
Therapeutic Target	Small molecule receptor (family A GPCR)	FFAR4	G-protein coupled receptor 120	Q5NUL3	CHEMBL5339
Therapeutic Target	Structural protein	LMNA	Prelamin-A/C	P02545	CHEMBL1293235
Therapeutic Target	Transcription factor	HIF1A	Hypoxia-inducible factor 1 alpha	Q16665	CHEMBL4261

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials
NP level	8

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT00029679	Borage Oil and Ginkgo Biloba (EGb 761) in Asthma	asthma	Linoleic Acid (NPC85813)	NP level
NCT04649203	Cytoflavin in the Treatment of Patients With Diabetic Polyneuropathy	diabetic neuropathy	Succinic Acid (NPC236709)	NP level
NCT00204932	Effects of CLA Supplements on Body Weight and Fat Oxidation	obesity	Linoleic Acid (NPC85813)	NP level
NCT00908791	Proof of Principle Trial to Determine if Nutritional Supplement Conjugated Linoleic Acid (CLA) Can Modulate the Lipogenic Pathway in Breast Cancer Tissue	breast cancer	Linoleic Acid (NPC85813)	NP level
NCT02063802	Metformin vs Conjugated Linoleic Acid and an Intervention Program With Healthy Habits in Obese Children	obesity	Linoleic Acid (NPC85813)	NP level
NCT00607945	Dietary Fatty Acids as Complementary Therapy in Type 2 Diabetes Mellitus	type 2 diabetes mellitus	Linoleic Acid (NPC85813)	NP level
NCT00951158	A Molecular Pharmacodynamic Dose-titration Trial of Conjugated Linoleic Acid (CLA; Clarinol®) in Patients With Advanced Solid Tumors	neoplasm	Linoleic Acid (NPC85813)	NP level
NCT01705652	Study to Assess the Activity of Nexrutine® in Prostate Cancer Patients	prostate cancer	Rutin (NPC176740)	NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Malignant neoplasms of biliary tract, distal bile duct Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C15	CSNK2A1,CSNK2A3,HIF1A,LMNA,MMP12,ESR2,AKR1B1,NOX4,CA4
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	AKR1C3,MMP12,THPO,CA12,NR1I2,ACHE,XDH,CA7,TTR
Malignant neoplasms of thymus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C27	MMP12,CYP1B1,AKR1B1,DPP4,FLT3,ACHE,PSMB5,FFAR4,ALOX15
Malignant neoplasms of adrenal gland Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D11	FFAR1,FABP3,MMP12,CYP19A1,NOX4,CA12,DPP4,CA4,CA7
Malignant neoplasms of thyroid gland, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D10.Z	FFAR1,MMP12,CYP1B1,NOX4,CA12,DPP4,XDH,CA7
Breast cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C60-2C6Y	ESR2,CYP19A1,MKNK1,CA12,CA4,MKNK2 NCT00908791
Pheochromocytoma Disease Category: X.Extension Codes Disease ICD-11 Code: XH3854	APP,MMP12,NOX4,CA4,ACHE,XDH,TTR
Hepatoblastoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.01	FABP3,MMP12,AKR1B1,CYP19A1,NOX4,CA12,CA4
Other specified malignant neoplasms of kidney, except renal pelvis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90.Y	CYP19A1,ACHE,XDH,FFAR4,MMP12,FFAR4
Squamous cell carcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.2	AKR1C3,MMP12,CA7,HSD17B1,CA12,XDH
Melanoma of skin Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C30	FABP3,FFAR1,APP,NOX4,NR1I2,TTR
Superficial ovarian endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10.B4	FABP3,HSD17B1,DPP4,CA4,ACHE,LMNA
Glioblastoma of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.00	CSNK2A3,LMNA,CYP1B1,CYP19A1,CA12,DPP4
Leishmaniasis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F54	MMP12,AKR1B1,NOX4,DPP4,FLT3
Other specified malignant neoplasms of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.Y	AKR1C3,MMP12,HSD17B1,CA12,XDH
Cytomegaloviral disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D82	CYP1A1,ESR2,THPO,ACHE,ALOX15
Chikungunya virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D40	FFAR1,HIF1A,CYP19A1,XDH,LMNA
Carpal tunnel syndrome Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C10.0	THPO,CYP1B1,NOX4,DPP4,FFAR4
Alzheimer disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A20	APP,ACHE,ESR2,FLT3
Adenocarcinoma of stomach Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72.0	MMP12,CYP19A1,NOX4,ALOX15
Malignant neoplasms of oesophagus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B70	MMP12,NOX4,ACHE,ALOX15
Urothelial carcinoma of bladder Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C94.2	AKR1B1,CYP1A2,HSD17B1,TTR
Malignant neoplasms of corpus uteri, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.Z	CYP1A1,MMP12,XDH,ALOX15
Renal cell carcinoma, chromophobe type Disease Category: X.Extension Codes Disease ICD-11 Code: XH6153	CYP1A1,CA12,CYP1A2,TTR
Colorectal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B91	FLT3,MKNK2,MKNK1
Acute diabete complication Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A2Y	FFAR1,AKR1B1,DPP4
Prostate cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C82	AKR1C3,ESR2 NCT01705652
Mature T-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A90	MKNK1,HIF1A,MKNK2
Asthma Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA23	MMP12,CA4 NCT00029679
Liver cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12	MKNK2,CSNK2A1,MKNK1
Psoriasis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA90	DPP4,FLT3 MMP12
Glaucoma Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9C61	AKR1B1,ACHE,CA4
Type 2 diabetes mellitus Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A11	DPP4,FFAR1 NCT00607945
Malignant neoplasm metastasis in lymph nodes of head, face or neck Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D60.0	AKR1C3,MMP12,NOX4
West Nile virus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D46	CYP19A1,DPP4,ACHE
Other specified malignant neoplasms ofcolon Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B90.Y	CYP1A1,MMP12,NOX4
Adenocarcinoma of prostate Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C82.0	NOX4,TTR,ALOX15
Systemic lupus erythematosus Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A40.0	CYP1A1,FFAR1,ACHE
Invasive carcinoma of breast Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C61	MMP12,THPO,CA12
Gliomas of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.0	AKR1C3,MMP12,NOX4
Myocardial infarction Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA41-BA43	THPO,DPP4
Idiopathic interstitial pneumonitis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CB03	FLT3,FFAR1
Parkinsonism Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A00	GSK3B,ACHE
Cushing syndrome Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A70	ESR2,CYP19A1
Seborrhoeic dermatitis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA81	CA4,CA12
Pain, unspecified Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG3Z	ACHE,AKR1B1
Myeloproliferative neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A20	FLT3,GSK3B
Amyloidosis Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5D00	APP,TTR
Neuropathy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C0Z	AKR1B1,CYP19A1
Bacterial infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1A00-1C4Z	CA12,CA4
Malignant haematopoietic neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B33	FLT3,DPP4
Acute myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A60	GSK3B,FLT3
Lung cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25	FLT3,MMP12
Obesity Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5B80-5B81	NCT00204932,NCT02063802
Inflammatory bowel diseases, unspecified Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD7Z	MMP12,NOX4
Pneumonia due to Pseudomonasaeruginosa Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA40.05	MMP12,DPP4
Chronic rhinosinusitis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA0A	MMP12,CYP1A1
Polycystic ovary syndrome Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A80.1	MMP12,FFAR4
Human immunodeficiency virus disease without mention of tuberculosis or malaria Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1C62	FFAR1,FLT3
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	AKR1C3,FABP3,HIF1A,LMNA,APP,CYP1B1,DPP4,NR1I2,ACHE,XDH,CA7,FFAR4,TTR,ALOX15
Diffuse large B-cell lymphomas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	THPO,CSNK2A2,NOX4,FABP3,CSNK2A1,CA12,NR1I2,AKR1B1,LMNA,FFAR1,ESR2,ACHE,PSMB5
Serous cystadenoma,borderline malignancy of ovary Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73.4	FABP3,CSNK2A1,CSNK2A3,MMP12,NOX4,CA12,CYP1A2,NR1I2,PSMB5,XDH,FFAR4,ALOX15
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	FFAR1,MMP12,AKR1B1,CYP19A1,DPP4,NR1I2,PSMB5,XDH,CA7,FFAR4,ALOX15
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	FFAR1,LMNA,MMP12,CSNK2A2,CA12,DPP4,FLT3,XDH,CA7,FFAR4,ALOX15
Germ cell tumour of testis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80.2	FABP3,HIF1A,APP,AKR1B1,NOX4,CA12,DPP4,CA4,ACHE,XDH,TTR
Solid tumour/cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00-2F9Z	MKNK2,CA4,HIF1A,GSK3B,APP,FLT3,XDH,CA12,MKNK1,CSNK2A1
Hepatocellular carcinoma of liver Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.02	AKR1C3,MMP12,CYP19A1,NOX4,CA12,CA4,AKR1C3,MMP12,CYP19A1,CA12
Chronic arterial occlusive disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD4Z	DPP4
Mature B-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A85	FLT3
Prostate hyperplasia Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA90	ESR2
Ischaemic/haemorrhagic stroke Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B20	THPO
Transplanted organ/tissue Disease Category: 24.Factors influencing health status or contact with health services Disease ICD-11 Code: QB63	FLT3
Unspecific substance harmful effect Disease Category: 22.Injury, poisoning or certain other consequences of external causes Disease ICD-11 Code: NE6Z	ACHE
Renal cell carcinoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90	MMP12
Mild neurocognitive disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6D71	ACHE
Cataract Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9B10	AKR1B1
Hepatitis virus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1E50-1E51	ESR2
Diabetes mellitus, type unspecified Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A14	DPP4
Menopausal disorder Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA30	ESR2
Indeterminate colitis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD72	ESR2
Rheumatoid arthritis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA20	AKR1B1
Vasomotor/allergic rhinitis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA08	ESR2
Hyper-lipoproteinaemia Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C80	ESR2
Inflammatory arthropathy Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA2Z	FLT3
Myasthenia gravis Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C6Y	ACHE
Bone/articular cartilage neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2F7B	FLT3
Encephalopathy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8E47	XDH
Mineral deficiency Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5B5K	XDH
Chronic myelomonocytic leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A40	FLT3
Coronavirus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D92	CSNK2A1
Human immunodeficiency virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1C60-1C62	FLT3
Multiple myeloma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A83	FLT3
Female pelvic pain Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA34	AKR1C3
Dementia Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6D80-6D8Z	ACHE
Dystrophic epidermolysis bullosa Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EC32	APP
Brain cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00	HIF1A
Schizophrenia Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A20	AKR1B1
Oesophagitis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA24	CYP19A1
Endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10	CYP19A1
Influenza Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1E30-1E32	XDH
Fragile X chromosome Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LD55	GSK3B
Ovarian cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73	FLT3
BCR-ABL1-negative chronic myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A41	FLT3
NA Disease Category: NA Disease ICD-11 Code: NA	NOX4
Osteosarcoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B51	GSK3B
Cardiomyopathy Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BC43	TTR
Parasitic worm infestation Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F90	ACHE
Diagnostic imaging Disease Category: NA Disease ICD-11 Code: N.A.	APP
Retinopathy Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9B71	APP
Metabolic disorder Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C50-5D2Z	DPP4
Myotonic disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C71	GSK3B
Gout Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA25	XDH
Oesophageal/gastroduodenal disorder Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD90	ACHE
Chronic kidney disease Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GB61	XDH
Chronic pain Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG30	FLT3
Unspecified viral infection of unspecified site Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D9Z	FLT3
Phakomatoses/hamartoneoplastic syndrome Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LD2D	FLT3
Adrenomedullary hyperfunction Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A75	HIF1A
Sepsis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1G40-1G41	ESR2
Diffuse large B-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	FLT3
Inborn purine/pyrimidine/nucleotide metabolism error Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C55	XDH
Peritoneal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C51	FLT3
Heart failure Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD10-BD1Z	XDH
Substance abuse Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6C40	ACHE
Thrombosis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB61-GB90	AKR1B1
Mastocytosis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A21	FLT3
Autism spectrum disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A02	DPP4
Pulmonary hypertension Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BB01	HIF1A
Desmoid tumour Disease Category: 02.Neoplasms Disease ICD-11 Code: 2F7C	APP
Pediculosis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1G00	ACHE
Diabetic polyneuropathy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C03.0	NCT04649203
Neoplasms Disease Category: 02.Neoplasms Disease ICD-11 Code: 02	NCT00951158
Crohn disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD70	MMP12
Coeliac disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA95	CYP1A1
Zika virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D48	ACHE
Osteoarthritis, unspecified Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA0Z	CA12
Dengue fever, unspecified Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D2Z	NR1I2
Idiopathic pulmonary fibrosis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CB03.4	MMP12
Atrial fibrillation Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BC81.3	CA7
Myotonic dystrophy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C71.0	CYP1A1
Keratoconus Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9A78.50	CA4
Pre-eclampsia Disease Category: 18.Pregnancy, childbirth or the puerperium Disease ICD-11 Code: JA24	CA4
Tetralogy of Fallot Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LA88.2	CA4
Systemic sclerosis Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A42	NOX4
Heart failure, unspecified Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD1Z	CYP1B1
Ebola virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D60.01	ACHE

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Senegalia Mellifera

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

Country/Region:

Traditional Medicine System:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

84 All known Ingredients in Total

43 Ingredients with Acceptable Bioavailablity

22 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Malignant neoplasms of biliary tract, distal bile duct

Adenocarcinoma of bronchus or lung

Malignant neoplasms of thymus

Malignant neoplasms of adrenal gland

Malignant neoplasms of thyroid gland, unspecified

Breast cancer

Pheochromocytoma

Hepatoblastoma

Other specified malignant neoplasms of kidney, except renal pelvis

Squamous cell carcinoma of bronchus or lung

Melanoma of skin

Superficial ovarian endometriosis

Glioblastoma of brain

Leishmaniasis

Other specified malignant neoplasms of bronchus or lung

Cytomegaloviral disease

Chikungunya virus disease

Carpal tunnel syndrome

Alzheimer disease

Adenocarcinoma of stomach

Malignant neoplasms of oesophagus

Urothelial carcinoma of bladder

Malignant neoplasms of corpus uteri, unspecified

Renal cell carcinoma, chromophobe type

Colorectal cancer

Acute diabete complication

Prostate cancer

Mature T-cell lymphoma

Asthma

Liver cancer

Psoriasis

Glaucoma

Type 2 diabetes mellitus

Malignant neoplasm metastasis in lymph nodes of head, face or neck

West Nile virus infection

Other specified malignant neoplasms ofcolon

Adenocarcinoma of prostate

Systemic lupus erythematosus

Invasive carcinoma of breast

Gliomas of brain

Myocardial infarction

Idiopathic interstitial pneumonitis

Parkinsonism

Cushing syndrome

Seborrhoeic dermatitis

Pain, unspecified

Myeloproliferative neoplasm

Amyloidosis

Neuropathy

Bacterial infection

Malignant haematopoietic neoplasm

Acute myeloid leukaemia

Lung cancer

Obesity

Inflammatory bowel diseases, unspecified

Pneumonia due to Pseudomonasaeruginosa

Chronic rhinosinusitis

Polycystic ovary syndrome

Human immunodeficiency virus disease without mention of tuberculosis or malaria

Adenocarcinoma of pancreas

Diffuse large B-cell lymphomas

Serous cystadenoma,borderline malignancy of ovary