• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Sambucus Ebulus


Example Image
PLANiTS DNA barcode

Click for details-----ITS

GTCGAAACCTGCACAGCAGAATGACCCGCGAACTCGTTCTCATATCGGGGCTCGTCGGCCTAGGCGCGCGAGCGCTCGGCCGGCGGACTTCGGTCAGGGCGCCCTCGGCGCGCTGACCAAACAACGAACCCCGGCGCGATCTGCGCCAAGGAATTTTTACTAAAGAGCTTGTCTATCGTTGCCCCGTTCGCGGTGTGCACGGTAGGCCCGCGCCTTTGAAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGMACGTCTGCCTGGGCGTCACACATTGCCGTCGCCCCCTTCCAATTTCCCATTCTCTGGGAACGCTGGCAGTCGGGCGGATATTGGCCTCCCGTGCTCCCGAGCGCGGTTGGCCCAAAAGCGAGTCCCGACAGCGGACGTCACGACAAGTGGTGGTTGAAAAGCCTTCTAATCCTGTCGTGCACCAATTCGTTGTCGCGGGCATCGAGTTGACCCTGACGCGTCGTCTCCGACGTCGCTCCGATC

Click for details-----ITS1

TGCAGAATCCACTGCGGAGATCATTGTCGAACCTGCACAGCAGAATGACCCGCGAACTCGTTTTCATATCGGGGCTCGTCGGCCTGGGTGCGCAAGCGCTCGGCCGGCGGACTTCGGTCAGGGCGCCCTCGGCGCGCTGACCAAACAACGAACCCCGGCGCGATCTGCGCCAAGGAATTTTTACTAAAGAGCGTGTCTATCGTCGCCCCGTTCGCGGTGTGCACGGCAGGCCTGCGCCTTTGAAACACAAA

Click for details-----ITS2

ATTGCCGTCGCCCCCTTCCAATTTCCCATTCTCTGGGAACGCTGGCAGTCGGGCGGATATTGGCCTCCCGTGCTCCCGAGCGCGGTTGGCCCAAAAGCGAGTCCCGACAGCGGACGTCACGACAAGTGGTGGTTGAAAAGCCTTCTAATCCTGTCGTGCACCAATTCGTTGTCGCGGGCATCGAGTTGACCCTGACGCGTCGTCTCCGACGTCGCTCCGATC
Taxonomic Information

Plant ID: NPO22227
Plant Latin Name: Sambucus Ebulus
Taxonomy Genus: Sambucus
Taxonomy Family: Adoxaceae

Plant External Links:

NCBI TaxonomyDB: 28503
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Turkey; Lebanon; Italy; Albania; India

Traditional Medicine System:
Indian Folk


Medicinal Functions:

Antiphlogistic; Antirheumatic; Appetite Suppressant; Cholagogue; Diaphoretic; Diuretic; Expectorant; Homeopathy; Poultice; Purgative

Geographical Distribution

Lebanon; Italy; Turkey; Albania; India

Geographical Distribution
+
−
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

72 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


59 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

27 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC92943

Ingredient ID: NPC90486

Ingredient ID: NPC85210

Ingredient ID: NPC74539

Ingredient ID: NPC73980

Ingredient ID: NPC72042

Ingredient ID: NPC71339

Ingredient ID: NPC70691

Ingredient ID: NPC65134

Ingredient ID: NPC53559

Ingredient ID: NPC502

Ingredient ID: NPC49074

Ingredient ID: NPC46254

Ingredient ID: NPC43246

Ingredient ID: NPC38742

Ingredient ID: NPC38212

Ingredient ID: NPC33415

Ingredient ID: NPC32991

Ingredient ID: NPC31279

Ingredient ID: NPC312132

Ingredient ID: NPC311783

Ingredient ID: NPC311255

Ingredient ID: NPC302857

Ingredient ID: NPC296071

Ingredient ID: NPC28828

Ingredient ID: NPC283170

Ingredient ID: NPC269242

Ingredient ID: NPC264784

Ingredient ID: NPC263089

Ingredient ID: NPC261644

Ingredient ID: NPC258476

Ingredient ID: NPC257124

Ingredient ID: NPC252587

Ingredient ID: NPC251666

Ingredient ID: NPC247553

Ingredient ID: NPC244315

Ingredient ID: NPC239039

Ingredient ID: NPC235260

Ingredient ID: NPC235190

Ingredient ID: NPC232375

Ingredient ID: NPC232141

Ingredient ID: NPC225709

Ingredient ID: NPC216825

Ingredient ID: NPC214971

Ingredient ID: NPC210456

Ingredient ID: NPC204388

Ingredient ID: NPC202992

Ingredient ID: NPC200838

Ingredient ID: NPC195355

Ingredient ID: NPC191103

Ingredient ID: NPC19003

Ingredient ID: NPC182468

Ingredient ID: NPC179987

Ingredient ID: NPC176819

Ingredient ID: NPC175771

Ingredient ID: NPC172625

Ingredient ID: NPC168290

Ingredient ID: NPC163984

Ingredient ID: NPC157340

Ingredient ID: NPC152384

Ingredient ID: NPC145463

Ingredient ID: NPC13990

Ingredient ID: NPC137949

Ingredient ID: NPC13449

Ingredient ID: NPC13304

Ingredient ID: NPC13143

Ingredient ID: NPC125085

Ingredient ID: NPC117299

Ingredient ID: NPC115919

Ingredient ID: NPC111690

Ingredient ID: NPC104190

Ingredient ID: NPC100773

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM
Target Type: Individual Protein of Homo sapiens
*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.
.

Detailed Information of Target Proteins

Target TypeProtein ClassGene IDProtein NameUniprot IDTarget ChEMBL ID
Cytochrome P450 Cytochrome P450 family 1 CYP1A2 Cytochrome P450 1A2 P05177 CHEMBL3356
Cytochrome P450 Cytochrome P450 family 1 CYP1A1 Cytochrome P450 1A1 P04798 CHEMBL2231
Therapeutic Target Hydrolase CDA Cytidine deaminase P32320 CHEMBL4502
Therapeutic Target Lyase CA9 Carbonic anhydrase IX Q16790 CHEMBL3594
Therapeutic Target Lyase CA12 Carbonic anhydrase XII O43570 CHEMBL3242
Therapeutic Target Other cytosolic protein MAPT Microtubule-associated protein tau P10636 CHEMBL1293224
Therapeutic Target Structural protein LMNA Prelamin-A/C P02545 CHEMBL1293235
Therapeutic Target Transferase TK1 Thymidine kinase, cytosolic P04183 CHEMBL2883
Showing 1 to 8 of 8 entries
Previous1Next
Clinical Trials Summary
Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type Number of clinical trials
NP level26
Clinical trial details
NCT IDTitleConditionForm in clinical useAssociated by plant or compound
NCT00003667 Combination Chemotherapy and Biological Therapy in Treating Patients With High-Risk Ewing's Sarcoma sarcoma Glycerin (NPC157340) NP level
NCT00005025 Gene Therapy in Treating Women With Refractory or Relapsed Ovarian Epithelial Cancer, Fallopian Tube Cancer, or Peritoneal Cancer fallopian tube cancer;ovarian cancer;peritoneum cancer Thymidine (NPC71339) NP level
NCT00210080 A Study to Diagnose Lung Cancer by Sputum Cytology (01-312) lung cancer Uridine (NPC43246) NP level
NCT00243711 A Multi-Center Randomized Study to Evaluate the Efficacy and Safety of an Investigational Lubricant Eye Drop dry eye syndrome Glycerin (NPC157340) NP level
NCT00322764 Phase II Study to Assess RG2417 in the Treatment of Bipolar I Depression bipolar disorder Uridine (NPC43246) NP level
NCT00533195 Comparison of UVA1 Phototherapy Versus Photochemotherapy for Patients With Severe Generalized Atopic Dermatitis atopic eczema Bergapten (NPC74539) NP level
NCT00580606 A Randomized, Double-Blind Placebo-Controlled Peanut Sublingual Immunotherapy Trial peanut allergic reaction Glycerin (NPC157340) NP level
NCT00619203 Oral Glycerol and High-Dose Rectal Paracetamol to Improve the Prognosis of Childhood Bacterial Meningitis bacterial meningitis Glycerin (NPC157340) NP level
NCT00691197 Safety and Acceptability of Using a Rewetting Drop With Contact Lens Wear Abnormality of refraction Glycerin (NPC157340) NP level
NCT00841256 Multicenter Trial of Sublingual Immunotherapy With a Solution of Grass Pollen Allergen Extract in Children allergic conjunctivitis Glycerin (NPC157340) NP level
Showing 1 to 10 of 26 entries
Previous123Next

❱❱❱ Associated Human Diseases and Detailed Association Evidence

 How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant
Association Type & Detailed Evidence
Acute diabete complication
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A2Y
 AKR1B1
Acute myeloid leukaemia
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A60
 MAPT,TK1
Acute pancreatitis
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DC31
 NCT02110810
Adenocarcinoma of bronchus or lung
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25.0
 CA12,CDA,TK1,CA9
Adenocarcinoma of pancreas
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C10.0
 LMNA,CA9,TK1
Allergic conjunctivitis
Disease Category: 09.Diseases of the visual system
Disease ICD-11 Code: 9A60.02
 NCT00841256
Allergic/hypersensitivity disorder
Disease Category: 04.Diseases of the immune system
Disease ICD-11 Code: 4A80-4A8Z
 NCT02936830
Alzheimer disease
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A20
 MAPT
Atopic eczema
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: EA80
 NCT03901144,NCT00533195
Bacterial infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1A00-1C4Z
 CA12
Showing 1 to 10 of 79 entries
Previous12345…8Next

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network 
Data Section
Select to Download
1. General Info & Plant Usage & Geographical Distribution  
2. Plant Ingredients  
3. Collective Molecular Proteins  
4. Collective Enriched Activities  
5. Plant molecular targets overlapping with DEGs  
6. Associated clinical trials  
7. Associated Human Diseases  
>> Targets derived from weak experimental activities
About Us

The CMAUP database is developed by the Bioinformatics & Drug Design group (BIDD) and School of Pharmacy, Fudan University.

CMAUP

Home

About

Browse

Help

Useful links

BIDD home

NPASS database

TCM-ID database

TTD database

Contact

826 Zhangheng Road, Pudong New District, Shanghai, China

Principle Investigator:
Prof. Chen Yu Zong
chenyuzong@sz.tsinghua.edu.cn
Prof. Zeng Xian
zengxian@fudan.edu.cn

Developer & Maintainer:
Ph.D. Student Dongyue Hou
dyhou22@m.fudan.edu.cn
Mr. Hanbo Lin
hblin19@fudan.edu.cn
Ms. Yuhan Feng
yhfeng22@m.fudan.edu.cn

© 2023 Copyright: Bioinformatics & Drug Design group