CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Achyranthes Aspera

Example Image

PLANiTS DNA barcode

Click for details-----ITS

TCGAAACCTGCCTAGCAGAGCGACCAGCGAACATGTTTACACATTGCAAGGGGAGGGGGTGCTGGCTTGTCCAGTCCCTCCCTAATGTTGGGACGTTACCCCTTCATTGGTGGTGCTGCCCGACACATTAACGAACCCCGGCGCAATACGCGCCAAGGAACAAAAAATGAGAGTGTGCTTATTCCCACTCGGGTTTCCGGGCGAGGATGTTTGCACCCAATCTAAGTCATTAAATGACTCTCGGCAACGGATATCTAGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGATTCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAAGCCTTTCGGCCAAGGCACGTCTGCCTGGGCGTCACGCATAGCGTCTATCCCCACCTCCAAAGTGTGGAGGGGAGAGGATGATGGCCTCCCATGCCTCACCGGGCGTGGATGGCCTAAATTAGGAAGCCTCGGGATACGAGATGCCGCGGCGATTGGTGGTTGTATACATGGCCTTCCTTCGCGTCGTGCATCATGTACCCTATGCGTCTTCGTAGGACCCTTTAAAACCTTTGCGACCCCAGGTCAGGCGGGGTTACCC

Click for details-----ITS1

TCGAAACCTGCCTAGCAGAGCGACCAGCGAACATGTTTACACATTGCAAGGGGAGGGGGTGCTGGCTTGTCCAGTCCCTCCCTAATGTTGGGGAGTTACCCCTTCATTGGTGGTGCTGCCCGACACATTAACGAACCCCGGCGCGATATGCGCCAAGGAACAAAAAATGAGAGTGTGCTTATTCCCACTTGGATTTCCGAGCGAGGATGTTTGCACCCAATCTAAGTCATTAAA

Click for details-----ITS2

ATAGCGTCTATCCCCACCTCCAAAGTGTGGAGGGGAGAGGATGATGGCCTCCCATGCCTCACCGGGCGTGGATGGCCTAAATTAGGAAGCCTCGGGATACGAGATGCCGCGGCGATTGGTGGTTGTATACATGGCCTTCCTTCGCGTCGTGCATCATGTACCCTATGCGTCTTCGTAGGACCCTTTAAAACCTTTGCGACCCCAGGTCAGGCGGGGTTACCC

Taxonomic Information

Plant ID: NPO20787
Plant Latin Name: Achyranthes Aspera
Taxonomy Genus: Achyranthes
Taxonomy Family: Amaranthaceae

Plant External Links:

NCBI TaxonomyDB: 240005
Plant-of-the-World-Online: Feb-68

Used in Medicines

Country/Region:

South Africa; Indonesia; India; China; Kenya; Nigeria; Burkina Faso

Traditional Medicine System:

Sowa-Rigpa; Indian Folk; Unani; Siddha; Ayurveda; TCM; Homeopathy

Medicinal Functions:

Antispasmodic; Astringent; Diuretic; Odontalgic

Geographical Distribution

Brazil; Italy; Bangladesh; Uganda; Kenya; Sudan; Guinea; Mali; Cambodia; Netherlands; Tanzania; Somalia; Peru; Laos; Austria; Nigeria; Bolivia; Cameroon; Burkina Faso; Ecuador; Benin; Ghana; Australia; Vanuatu; Cuba; Thailand; Venezuela; Japan; Cape Verde; Papua New Guinea; Cote d'Ivoire; Portugal; China; Oman; Senegal; Dominican Republic; Belize; United States; Sierra Leone; Spain; Liberia; Maldives; Swaziland; Pakistan; Gambia; Philippines; Indonesia; New Caledonia; Mauritius; Sri Lanka; Mauritania; Vietnam; French Guiana; Guinea-Bissau; Guyana; Namibia; Honduras; New Zealand; Nepal; Haiti; Jamaica; Seychelles; Angola; Myanmar; Chad; Mexico; Nicaragua; South Africa; India; Lesotho; Djibouti; Congo; Mozambique; Colombia; Burundi; Gabon; Taiwan; Fiji; Botswana; Suriname

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

49 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

12 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

20 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC97202

Ingredient ID: NPC93284

Ingredient ID: NPC85015

Ingredient ID: NPC83546

Ingredient ID: NPC79274

Ingredient ID: NPC77174

Ingredient ID: NPC75439

Ingredient ID: NPC51700

Ingredient ID: NPC50763

Ingredient ID: NPC46157

Ingredient ID: NPC43241

Ingredient ID: NPC3957

Ingredient ID: NPC303424

Ingredient ID: NPC300637

Ingredient ID: NPC298268

Ingredient ID: NPC291638

Ingredient ID: NPC285423

Ingredient ID: NPC274613

Ingredient ID: NPC265294

Ingredient ID: NPC264935

Ingredient ID: NPC258051

Ingredient ID: NPC240722

Ingredient ID: NPC239608

Ingredient ID: NPC238626

Ingredient ID: NPC237627

Ingredient ID: NPC23465

Ingredient ID: NPC234196

Ingredient ID: NPC230301

Ingredient ID: NPC229663

Ingredient ID: NPC228170

Ingredient ID: NPC222342

Ingredient ID: NPC206467

Ingredient ID: NPC203411

Ingredient ID: NPC191082

Ingredient ID: NPC191010

Ingredient ID: NPC185810

Ingredient ID: NPC177340

Ingredient ID: NPC164031

Ingredient ID: NPC162393

Ingredient ID: NPC147802

Ingredient ID: NPC147217

Ingredient ID: NPC145879

Ingredient ID: NPC141447

Ingredient ID: NPC118614

Ingredient ID: NPC111888

Ingredient ID: NPC110699

Ingredient ID: NPC110388

Ingredient ID: NPC108689

Ingredient ID: NPC106055

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Therapeutic Target	Enzyme	RECQL	ATP-dependent DNA helicase Q1	P46063	CHEMBL1293236
Therapeutic Target	Enzyme	CES1	Acyl coenzyme A:cholesterol acyltransferase	P23141	CHEMBL2265
Therapeutic Target	Nuclear hormone receptor subfamily 1	RORC	Nuclear receptor ROR-gamma	P51449	CHEMBL1741186
Therapeutic Target	Nuclear hormone receptor subfamily 1	NR1H4	Bile acid receptor FXR	Q96RI1	CHEMBL2047
Therapeutic Target	Transcription factor	RELA	Nuclear factor NF-kappa-B p65 subunit	Q04206	CHEMBL5533

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials
NP level	4

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT03216876	A Study Of Ursolic Acid For Primary Sclerosing Cholangitis	sclerosing cholangitis	Ursolic Acid (NPC51700)	NP level
NCT02468687	NMP in Relapsed / Refractory Myeloma	multiple myeloma	1-Methylpyrrolidin-2-One (NPC234196)	NP level
NCT02337933	Effect of Ursolic Acid Administration on Insulin Sensitivity and Metabolic Syndrome	metabolic syndrome	Ursolic Acid (NPC51700)	NP level
NCT04403568	Testing the Synergism of Phytonutrients, Curcumin and Ursolic Acid, to Target Molecular Pathways in the Prostate	prostate cancer	Ursolic Acid (NPC51700)	NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Multiple sclerosis Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A40	RELA,RORC,F2
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	F2,CES1,RECQL
Solid tumour/cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00-2F9Z	RORC,RELA
Type 2 diabetes mellitus Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A11	F2,RELA
Psoriasis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA90	RORC,RELA
Tetralogy of Fallot Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LA88.2	F2,RORC
Skin and skin-structure infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F28-1G0Z	RELA
Cardiovascular disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA00-BE2Z	F2
Indeterminate colitis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD72	RELA
Chronic arterial occlusive disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD4Z	CES1
Myocardial infarction Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA41-BA43	F2
Acute/subacute hepatic failure Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB91	RELA
Thrombocytopenia Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3B64	F2
Peroxisomal disease Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C57	CES1
Muscular dystrophy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C70	RELA
Coagulation defect Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3B10	F2
Bleeding disorder Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA20-GA21	F2
Diabetes mellitus, type unspecified Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A14	RELA
Irritable bowel syndrome Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD91	RELA
Lung cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25	RORC
Thrombosis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB61-GB90	F2
Fungal infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F29-1F2F	RELA
Asthma Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA23	F2
Coronary thrombosis Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA43	F2
Rheumatoid arthritis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA20	RELA
Cerebral ischaemic stroke Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B11	F2
Crohn disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD70	RORC
Atopic eczema Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA80	RELA
Acute myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A60	RELA
Hyper-lipoproteinaemia Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C80	CES1
Angina pectoris Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA40	F2
Nutritional deficiency Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5B50-5B71	F2
Choreiform disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A01	RELA
Autoimmune disease Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A40-4A45	RORC
Ischaemic/haemorrhagic stroke Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B20	F2
Lupus erythematosus Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A40	RELA
Synthesis disorder Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C52-5C59	CES1
Metabolic disorder Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C50-5D2Z	NCT02337933
Prostate cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C82	NCT04403568
Primary sclerosing cholangitis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB96.2	NCT03216876
Multiple myeloma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A83	NCT02468687
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	RORC
Serous cystadenoma,borderline malignancy of ovary Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73.4	RORC
Pheochromocytoma Disease Category: X.Extension Codes Disease ICD-11 Code: XH3854	RORC
Adenocarcinoma of stomach Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72.0	F2
Malignant neoplasm metastasis in lymph nodes of head, face or neck Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D60.0	F2
Diffuse large B-cell lymphomas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	RECQL
Squamous cell carcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.2	F2
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	RECQL
Other specified malignant neoplasms ofcolon Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B90.Y	F2
Other specified malignant neoplasms of kidney, except renal pelvis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90.Y	F2
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	F2
Malignant neoplasms of corpus uteri, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.Z	F2
Germ cell tumour of testis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80.2	F2

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Achyranthes Aspera

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

Country/Region:

Traditional Medicine System:

Medicinal Functions:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

49 All known Ingredients in Total

12 Ingredients with Acceptable Bioavailablity

20 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Multiple sclerosis

Adenocarcinoma of pancreas

Solid tumour/cancer

Type 2 diabetes mellitus

Psoriasis

Tetralogy of Fallot

Skin and skin-structure infection

Cardiovascular disease

Indeterminate colitis

Chronic arterial occlusive disease

Myocardial infarction

Acute/subacute hepatic failure

Thrombocytopenia

Peroxisomal disease

Muscular dystrophy

Coagulation defect

Bleeding disorder

Diabetes mellitus, type unspecified

Irritable bowel syndrome

Lung cancer

Thrombosis

Fungal infection

Asthma

Coronary thrombosis

Rheumatoid arthritis

Cerebral ischaemic stroke

Crohn disease

Atopic eczema

Acute myeloid leukaemia

Hyper-lipoproteinaemia

Angina pectoris

Nutritional deficiency

Choreiform disorder

Autoimmune disease

Ischaemic/haemorrhagic stroke

Lupus erythematosus

Synthesis disorder

Metabolic disorder

Prostate cancer

Primary sclerosing cholangitis

Multiple myeloma

Carcinosarcoma of uterus

Serous cystadenoma,borderline malignancy of ovary

Pheochromocytoma

Adenocarcinoma of stomach

Malignant neoplasm metastasis in lymph nodes of head, face or neck

Diffuse large B-cell lymphomas

Squamous cell carcinoma of bronchus or lung

Mesothelioma of pleura

Other specified malignant neoplasms ofcolon

Other specified malignant neoplasms of kidney, except renal pelvis

Adenocarcinoma of bronchus or lung

Malignant neoplasms of corpus uteri, unspecified

Germ cell tumour of testis

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

>> Targets derived from weak experimental activities