• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Callistemon Viminalis


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAATCCTGCACAGCAGAATGACCAGAGAACTAGTAACAAACTCGATGGGGGCGGTGGGCTTCGCTCAACGTCCCCCGACGCTTGGATCGCGCGGGCGCCTAGTGCGCTCGGGCGTTTCTCGGCGGCAATAACGAACCCCGGCGCGGAATGCGCCAAGGAACTCAAACAAGAGTGCGATGCTCCCATCACCCCAGACATGGTGCGTGCATGGGATGCCATGCAATCTCCTATTTACTTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAACTGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGTAACCATCCGGTGAGGGCACGTTTGCCTGGGTGTCACACATGGCGTTGCCCCTTATCCCTCGCCTTGAATTTGGGCGGGGAGGAATTTGGGCGCGTAAGTTGGCCTCCCGTGACAACCTTGTCCCGGTTGGCCGAAAATCGAGCGTCGGAGCGATTAGCACCACGACATTTGGTGGTTGATTAGAAGACCCCAATGGTCAATGTCGTGCGTGCTCGCTCGTGCGCGCGCTCTGCGAATCTTTTATTTACCAACGCGACCCCA

Click for details-----ITS1

NA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO20212
Plant Latin Name: Callistemon Viminalis
Taxonomy Genus: Callistemon
Taxonomy Family: Myrtaceae

Plant External Links:

NCBI TaxonomyDB: 73737
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available
Compounds Summary

Overview of Ingredients

85 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


32 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

24 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.





Ingredient Structrual Cards

Ingredient ID: NPC90841

Ingredient ID: NPC86496

Ingredient ID: NPC78159

Ingredient ID: NPC74910

Ingredient ID: NPC71283

Ingredient ID: NPC65840

Ingredient ID: NPC62049

Ingredient ID: NPC59650

Ingredient ID: NPC51939

Ingredient ID: NPC480899

Ingredient ID: NPC480898

Ingredient ID: NPC48057

Ingredient ID: NPC46864

Ingredient ID: NPC41029

Ingredient ID: NPC40592

Ingredient ID: NPC39822

Ingredient ID: NPC37623

Ingredient ID: NPC34808

Ingredient ID: NPC320968

Ingredient ID: NPC31991

Ingredient ID: NPC31494

Ingredient ID: NPC314743

Ingredient ID: NPC307792

Ingredient ID: NPC307131

Ingredient ID: NPC301470

Ingredient ID: NPC300059

Ingredient ID: NPC299475

Ingredient ID: NPC297581

Ingredient ID: NPC29224

Ingredient ID: NPC278153

Ingredient ID: NPC271150

Ingredient ID: NPC265662

Ingredient ID: NPC261153

Ingredient ID: NPC259688

Ingredient ID: NPC257668

Ingredient ID: NPC257640

Ingredient ID: NPC257194

Ingredient ID: NPC256892

Ingredient ID: NPC249967

Ingredient ID: NPC244543

Ingredient ID: NPC242930

Ingredient ID: NPC242428

Ingredient ID: NPC241279

Ingredient ID: NPC235080

Ingredient ID: NPC233832

Ingredient ID: NPC228039

Ingredient ID: NPC226453

Ingredient ID: NPC223059

Ingredient ID: NPC222618

Ingredient ID: NPC22228

Ingredient ID: NPC219397

Ingredient ID: NPC216199

Ingredient ID: NPC208949

Ingredient ID: NPC208573

Ingredient ID: NPC206510

Ingredient ID: NPC205926

Ingredient ID: NPC200061

Ingredient ID: NPC194883

Ingredient ID: NPC189079

Ingredient ID: NPC187648

Ingredient ID: NPC18603

Ingredient ID: NPC183927

Ingredient ID: NPC182238

Ingredient ID: NPC178212

Ingredient ID: NPC17810

Ingredient ID: NPC178085

Ingredient ID: NPC174146

Ingredient ID: NPC170427

Ingredient ID: NPC15636

Ingredient ID: NPC154213

Ingredient ID: NPC153923

Ingredient ID: NPC147092

Ingredient ID: NPC146795

Ingredient ID: NPC143726

Ingredient ID: NPC133609

Ingredient ID: NPC131486

Ingredient ID: NPC129226

Ingredient ID: NPC128828

Ingredient ID: NPC127508

Ingredient ID: NPC124598

Ingredient ID: NPC122752

Ingredient ID: NPC114685

Ingredient ID: NPC110406

Ingredient ID: NPC103518

Ingredient ID: NPC103483

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM
Target Type: Individual Protein of Homo sapiens
*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.
.

Detailed Information of Target Proteins

Target Type Protein Class Gene ID Protein Name Uniprot ID Target ChEMBL ID
Therapeutic Target Enzyme BLM Bloom syndrome protein P54132 CHEMBL1293237
Therapeutic Target Peptide receptor (family A GPCR) TSHR Thyroid stimulating hormone receptor P16473 CHEMBL1963
Drug Transporter SLC superfamily of solute carriers SLCO1B1 Solute carrier organic anion transporter family member 1B1 Q9Y6L6 CHEMBL1697668
Therapeutic Target Small molecule receptor (family A GPCR) CNR1 Cannabinoid CB1 receptor P21554 CHEMBL218
Therapeutic Target Small molecule receptor (family A GPCR) CNR2 Cannabinoid CB2 receptor P34972 CHEMBL253
Therapeutic Target Small molecule receptor (family A GPCR) ADRA2A Alpha-2a adrenergic receptor P08913 CHEMBL1867
Therapeutic Target Transcription factor NFKB1 Nuclear factor NF-kappa-B p105 subunit P19838 CHEMBL3251
Therapeutic Target Transient receptor potential channel TRPV1 Vanilloid receptor Q8NER1 CHEMBL4794
Clinical Trials Summary
Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type Number of clinical trials
NP level190
Clinical trial details
NCT ID Title Condition Form in clinical use Associated by plant or compound
NCT01983683 Efficacy and Safety of Cadazolid Versus Vancomycin in Subjects With Clostridium Difficile-associated Diarrhea clostridium difficile infection Vancomycin (NPC314743) NP level
NCT00228410 Study Comparing Tigecycline and Vancomycin With Aztreonam in Complicated Skin and Skin Structure Infections skin disease Vancomycin (NPC314743) NP level
NCT01191840 Treatment Algorithm to Reduce the Use of Vancomycin in Adults With Blood Stream Infection bacteriemia Vancomycin (NPC314743) NP level
NCT00047983 Omega-3 Fatty Acids That Affect the Immune System in Kidney Transplant Patients kidney disease Arginine (NPC226453) NP level
NCT02432807 Safety and Efficacy of Vancomycin Ophthalmic Ointment in Patients With Moderate to Severe Bacterial Conjunctivitis bacterial conjunctivitis Vancomycin (NPC314743) NP level
NCT00384527 Study of Nitazoxanide in the Treatment of Clostridium Difficile-associated Disease commensal Clostridium infectious disease Vancomycin (NPC314743) NP level
NCT04898348 A Study to Investigate Efficacy and Safety of KBL697 in Patients With Mild to Moderate Active Ulcerative Colitis ulcerative colitis Vancomycin (NPC314743) NP level
NCT01987895 Efficacy and Safety of Cadazolid Versus Vancomycin in Subjects With Clostridium Difficile - Associated Diarrhea clostridium difficile infection Vancomycin (NPC314743) NP level
NCT00037050 Antibiotic Treatment for Infections of Short Term In-dwelling Vascular Catheters Due to Gram Positive Bacteria bacteriemia;gram-positive bacterial infections Vancomycin (NPC314743) NP level
NCT03796650 Fecal Transplantation for Primary Clostridium Difficile Infection clostridium difficile infection Vancomycin (NPC314743) NP level
NCT02092935 A Study of SMT19969 Compared With Vancomycin for the Treatment of Clostridium Difficile-Associated Diarrhoea (CDAD) clostridium difficile infection Vancomycin (NPC314743) NP level
NCT00000161 Randomized Trials of Vitamin Supplements and Eye Disease cataract;macular degeneration Beta Carotene (NPC17810) NP level
NCT00917826 Study of Arginine Butyrate and Ganciclovir/Valganciclovir in EBV(+) Lymphoid Malignancies lymphoma Arginine (NPC226453) NP level
NCT04983901 PHASE II SINGLE-CENTER, RANDOMIZED, OPEN-LABEL, PROSPECTIVE, STUDY TO DETERMINE THE IMPACT OF SERIAL PROCALCITONIN hematopoietic and lymphoid cell neoplasm Vancomycin (NPC314743) NP level
NCT00124020 Comparison of Telavancin and Vancomycin for Hospital-acquired Pneumonia Due to Methicillin-resistant Staphylococcus Aureus bacterial pneumonia Vancomycin (NPC314743) NP level
NCT00345150 Effects of Inhibition of NO-Synthesis on Renal Hemodynamics and Sodium Excretion in Patients With Essential Hypertension and Healthy Controls hypertension Arginine (NPC226453) NP level
NCT04678154 Evaluation of a New Strategy for Protocolized Antibiotic Care for Severe Open Fractures: SEXTANT infection Vancomycin (NPC314743) NP level
NCT01142219 L-Arginine and Sickle Cell Disease sickle cell anemia Arginine (NPC226453) NP level
NCT03827447 Vancomycin for the Treatment of NAAT(+)/Toxin(-) C. Difficile clostridium difficile infection Vancomycin (NPC314743) NP level
NCT02765256 Fundamental Modification of the Gut Microbiota in the Treatment of Refractory Crohn's Disease Crohn's disease Vancomycin (NPC314743) NP level
NCT04017468 Suprafascial Vancomycin Powder for Prevention of Surgical Site Infections After Instrumented Posterior Spinal Fusion infection Vancomycin (NPC314743) NP level
NCT01515020 Daptomycin Versus Vancomycin in the Treatment of Nosocomial or Healthcare-associated MRSA Bacteremia nosocomial infection Vancomycin (NPC314743) NP level
NCT03030248 Vancomycin for C Difficile NAAT+/EIA- Hematology Oncology Patients clostridium difficile infection Vancomycin (NPC314743) NP level
NCT01798537 Simplified Selective Digestive Tract Decontamination for the Prevention of Intensive Care Unit Acquired Infections bacteriemia;pneumonia Vancomycin (NPC314743) NP level
NCT03817125 Melanoma Checkpoint and Gut Microbiome Alteration With Microbiome Intervention metastatic melanoma Vancomycin (NPC314743) NP level
NCT02099240 Patients Response to Early Switch To Oral:Osteomyelitis Study osteomyelitis Vancomycin (NPC314743) NP level
NCT03446456 Vasopressin and Pain Perception in the Brain pain Arginine (NPC226453) NP level
NCT00062647 Telavancin for Treatment of Uncomplicated Staphylococcus Aureus Bacteremia gram-positive bacterial infections Vancomycin (NPC314743) NP level
NCT01603446 L-arginine Therapy on Endothelium-dependent Vasodilation & Mitochondrial Metabolism in MELAS Syndrome MELAS Arginine (NPC226453) NP level
NCT02017249 Efficacy Study of Oral Arginine to Improve Immune Function in Glioblastoma Multiforme glioblastoma multiforme Arginine (NPC226453) NP level
NCT04247542 ACX-362E [Ibezapolstat] for Oral Treatment of Clostridioides Difficile Infection clostridium difficile infection Vancomycin (NPC314743) NP level
NCT00217165 Taurine as an Anti-Manic Agent: A Double-Blind, Placebo-Controlled Study bipolar disorder Taurine (NPC300059) NP level
NCT00345605 Arginine and Buphenyl in Patients With Argininosuccinic Aciduria (ASA), a Urea Cycle Disorder argininosuccinic aciduria Arginine (NPC226453) NP level
NCT01287585 Ph 3 ADI-PEG 20 Versus Placebo in Subjects With Advanced Hepatocellular Carcinoma Who Have Failed Prior Systemic Therapy hepatocellular carcinoma Arginine (NPC226453) NP level
NCT04750902 A Clinical Trial to Assess the Safety and the Anti-caries Efficacy of COL 101 (Arginine) Non-fluoride Dentifrices in Comparison With 0.24% Sodium Fluoride (1100 Ppm F) Dentifrice Control in 10 to 14-year-old Children dental caries Arginine (NPC226453) NP level
NCT03105479 Comparison of Cadazolid Versus Vancomycin in Children With Clostridium Difficile-associated Diarrhea (CDAD) clostridium difficile infection Vancomycin (NPC314743) NP level
NCT01222702 Efficacy, Safety and Tolerability of Cadazolid in Subjects With Clostridium Difficile Associated Diarrhea (CDAD) clostridium difficile infection Vancomycin (NPC314743) NP level
NCT00391001 Taurine in Adolescents With Bipolar Disorder bipolar disorder Taurine (NPC300059) NP level
NCT01796678 Arginine Therapy in Sickle Cell Disease-VOC Clinical Trial pain Arginine (NPC226453) NP level
NCT00420823 A Study of Taurine in Patients With First-episode Psychosis Receiving Antipsychotic Treatment mental or behavioural disorder Taurine (NPC300059) NP level
NCT01598311 A Study of CB-183,315 in Participants With Clostridium Difficile Associated Diarrhea (MK-4261-006) clostridium difficile infection Vancomycin (NPC314743) NP level
NCT00056433 Evaluation of Hydroxyurea Plus L-arginine or Sildenafil to Treat Sickle Cell Anemia sickle cell anemia Arginine (NPC226453) NP level
NCT01400867 Safety and Efficacy Study of Ceftaroline Versus a Comparator in Pediatric Subjects With Complicated Skin Infections infection Vancomycin (NPC314743) NP level
NCT00091819 Comparison of Telavancin and Vancomycin for Complicated Skin and Skin Structure Infections With a Focus on Methicillin-resistant Staphylococcus Aureus staphylococcal skin infections Vancomycin (NPC314743) NP level
NCT01984684 Delafloxacin vs Vancomycin and Aztreonam for the Treatment of Acute Bacterial Skin and Skin Structure Infections infection;bacterial disease Vancomycin (NPC314743) NP level
NCT03595553 Comparison of Ridinilazole Versus Vancomycin Treatment for Clostridium Difficile Infection infection Vancomycin (NPC314743) NP level
NCT04042077 Delafloxacin IV and OS Administration Compared to Best Available Therapy in Patients With Surgical Site Infections infection Vancomycin (NPC314743) NP level
NCT02344511 Dalbavancin vs Comparator in Pediatric Subjects With Acute Hematogenous Osteomyelitis osteomyelitis Vancomycin (NPC314743) NP level
NCT03685747 Vancomycin Pharmacokinetics in Patients on Peritoneal Dialysis peritonitis Vancomycin (NPC314743) NP level
NCT05266807 Fecal Microbiota Transplantation in Clostridioides Difficile Infection First Episode and First Recurrence infection Vancomycin (NPC314743) NP level
NCT02291458 L-arginine and Brown Adipose Tissue Glucose intolerance Arginine (NPC226453) NP level
NCT00423657 Comparative Study of Ceftaroline vs. Vancomycin Plus Aztreonam in Adult Subjects With Complicated Skin Infections bacterial disease Vancomycin (NPC314743) NP level
NCT02301221 Effect of Fecal Microbiota Transplantation in Slow Transit Constipation Constipation Vancomycin (NPC314743) NP level
NCT02663596 Safety and TDM of Continuous Infusion Vancomycin Through Continuous Renal Replacement Therapy Solution kidney failure Vancomycin (NPC314743) NP level
NCT03506347 Regional Prophylactic Vancomycin With Restricted Tourniquet Time in Primary Total Knee Replacement Arthropathy Vancomycin (NPC314743) NP level
NCT01283581 A Study to Assess Objective Endpoint Measurements of Response in Bacterial Skin Infections bacterial disease Vancomycin (NPC314743) NP level
NCT04249336 Clinical Efficacy Of BioMin F, Colgate Sensitive Pro-Relief And Sensodyne Rapid Action Dentifrices In DH allergic disease Arginine (NPC226453) NP level
NCT02790996 Neonatal Vancomycin Trial Neonatal sepsis Vancomycin (NPC314743) NP level
NCT02227446 Local Antibiotic Therapy to Reduce Infection After Operative Treatment of Fractures at High Risk of Infection: A Multicenter Randomized, Controlled Trial (VANCO) infection Vancomycin (NPC314743) NP level
NCT00442832 TD-1792 in Gram-positive Complicated Skin and Skin Structure Infection staphylococcal skin infections Vancomycin (NPC314743) NP level
NCT05320068 Oral Vancomycin vs Placebo in the Prevention of Recurrence of Clostridioides Difficile's Infection infection Vancomycin (NPC314743) NP level
NCT00223717 Treatment of Supine Hypertension in Autonomic Failure hypertension Arginine (NPC226453) NP level
NCT02447874 Arginine Therapy for the Treatment of Pain in Children With Sickle Cell Disease sickle cell anemia Arginine (NPC226453) NP level
NCT01792804 Staphylococcus Aureus Bacteremia Antibiotic Treatment Options Staphylococcus aureus infection Vancomycin (NPC314743) NP level
NCT02743234 Fecal Microbiota Transplantation for Relapsing Clostridium Difficile Infection clostridium difficile infection Vancomycin (NPC314743) NP level
NCT02774382 Rectal Bacteriotherapy, Fecal Microbiota Transplantation or Oral Vancomycin Treatment of Recurrent Clostridium Difficile Infections commensal Clostridium infectious disease Vancomycin (NPC314743) NP level
NCT01607879 Use of β-hydroxy-β-methylbutyrate to Counteract Muscle Loss in Men With Prostate Cancer on Androgen Ablation prostate cancer Arginine (NPC226453) NP level
NCT02208063 A Phase 3 Telavancin Staphylococcus Aureus (S. Aureus) Bacteremia Trial bacteriemia Vancomycin (NPC314743) NP level
NCT00405665 The Short Term Safety and Efficacy of Inhaled L-arginine in Patients With Cystic Fibrosis cystic fibrosis Arginine (NPC226453) NP level
NCT05076955 Evaluating the Healing of Diabetic Foot Ulcers With Compounded Anti-Infective Irrigation Therapy diabetic foot Vancomycin (NPC314743) NP level
NCT04631536 Managing Endothelial Dysfunction in COVID-19 : A Randomized Controlled Trial at LAUMC COVID-19 Arginine (NPC226453) NP level
NCT00428844 Study of Daptomycin in Subjects Undergoing Surgery for Osteomyelitis Associated With an Infected Prosthetic Caused by Staphylococci osteomyelitis Vancomycin (NPC314743) NP level
NCT01439555 Endothelial Facilitation in Alzheimer's Disease Alzheimer disease Arginine (NPC226453) NP level
NCT01324115 NG-Nitro-L-Arginine in Treating Patients With Advanced Solid Tumors neoplasm Arginine (NPC226453) NP level
NCT01925066 Aerosolized Vancomycin in Methicillin-Resistant Staphylococcus Aureus Pneumonia Under Mechanical Ventilation staphylococcal pneumonia;Staphylococcus aureus infection Vancomycin (NPC314743) NP level
NCT02730962 Interventional Bioremediation of Microbiota in Metabolic Syndrome prediabetes syndrome Vancomycin (NPC314743) NP level
NCT00005107 Role of Nitric Oxide in Cirrhosis: Relationship With Systemic Hemodynamics, Renal Function, Vasoactive Systems and Endotoxemia cirrhosis of liver Arginine (NPC226453) NP level
NCT00974714 L-arginine Effects on Chronic Hypertension in Pregnancy preeclampsia Arginine (NPC226453) NP level
NCT02504554 Beneficial Bacteria Treatment for Autism autism spectrum disorder Vancomycin (NPC314743) NP level
NCT00157521 L-Arginine in Pre-Eclampsia preeclampsia Arginine (NPC226453) NP level
NCT00408577 Prevention of Cardiac and Vascular Events in Patients With NGT/IGT. cardiovascular disease Arginine (NPC226453) NP level
NCT00695903 Phase 2 Study of Safety, Efficacy, and Pharmacokinetics of Higher Doses of Daptomycin and Vancomycin in MRSA Bacteremia infective endocarditis Vancomycin (NPC314743) NP level
NCT02686645 Fecal Microbiota Therapy for Recurrent Clostridium Difficile Infection clostridium difficile infection Vancomycin (NPC314743) NP level
NCT02607618 Phase 3 Study to Evaluate Safety and Efficacy of Iclaprim Versus Vancomycin for ABSSSI: REVIVE-2 infection Vancomycin (NPC314743) NP level
NCT03476317 Pilot Study of Fundamental Modification of the Gut Microbiota in the Treatment of Refractory Crohn's Disease Crohn's disease Vancomycin (NPC314743) NP level
NCT00210899 Ceftobiprole in the Treatment of Resistant Staphylococcus Aureus Skin and Skin Structure Infections staphylococcal skin infections;skin disease Vancomycin (NPC314743) NP level
NCT01802073 Primary Sclerosing Cholangitis With Oral Vancomycin by the Study of Its Antimicrobial and Immunomodulating Effects sclerosing cholangitis Vancomycin (NPC314743) NP level
NCT00543608 Clinical Efficacy of Intravenous Iclaprim Versus Vancomycin in the Treatment of Hospital-Acquired, Ventilator-Associated, or Health-Care-Associated Pneumonia ventilator-associated pneumonia Vancomycin (NPC314743) NP level
NCT05370885 VE202 in Patients With Mild-to-Moderate Ulcerative Colitis ulcerative colitis Vancomycin (NPC314743) NP level
NCT00134433 Endothelial Modulation for Angiogenic Therapy coronary artery disease Arginine (NPC226453) NP level
NCT02388178 To Determine the Ability of a New Product Formulation to Remineralize an Early Caries Lesion by an In-situ Study dental caries Arginine (NPC226453) NP level
NCT00344916 Phase 1 Study of L-NMMA in Patients With Liver Cirrhosis cirrhosis of liver Arginine (NPC226453) NP level
NCT04816968 Antibiotics Continuous Infusion at Home bacterial disease Vancomycin (NPC314743) NP level
NCT00107952 Comparison of Telavancin and Vancomycin for Hospital-acquired Pneumonia Due to Methicillin-resistant Staphylococcus Aureus bacterial pneumonia Vancomycin (NPC314743) NP level
NCT05042024 Supplementation With L-ornithine But Not L-arginine Increases Density of CD68+ and CD163+ Macrophages in Periodontitis periodontitis Arginine (NPC226453) NP level
NCT01757236 Efficacy and Safety Study of Antibiotic Treatment to Treat Hip Prosthetic Joint Infection infection Vancomycin (NPC314743) NP level
NCT03679780 The Effect of Endothelin and L-Arginine on Racial Differences in Vasoconstriction cardiovascular disease Arginine (NPC226453) NP level
NCT05470998 L-Arginine in Children Having Sickle Cell Disease With Increased Tricuspid Regurgitant Jet Velocity sickle cell anemia Arginine (NPC226453) NP level
NCT00314951 Fidaxomicin Versus Vancomycin for the Treatment of Clostridium Difficile-Associated Diarrhea (CDAD) (MK-5119-018) commensal Clostridium infectious disease;Diarrhea Vancomycin (NPC314743) NP level
NCT00424190 Comparative Study of Ceftaroline vs. Vancomycin Plus Aztreonam in Adult Subjects With Complicated Skin Infections bacterial disease Vancomycin (NPC314743) NP level
NCT03452189 The Effect of an Antibiotic on the Production of Uremic Toxins by the Gut Microbiome chronic kidney disease Vancomycin (NPC314743) NP level
NCT00147368 Arginine Malaria Trial: Study of Adjunctive Arginine in Falciparum Malaria Plasmodium falciparum malaria Arginine (NPC226453) NP level
NCT04535427 Role of L-Arginine Supplementation in the Treatment of Rheumatoid Arthritis rheumatoid arthritis Arginine (NPC226453) NP level
NCT02857582 Transplantation of Cultured Gut Microflora to Repeat Antibiotic-induced Diarrhea Due to Clostridium Difficile commensal Clostridium infectious disease Vancomycin (NPC314743) NP level
NCT01339091 Efficacy and Safety of Dalbavancin for the Treatment of Acute Bacterial Skin and Skin Structure Infections abscess;cellulitis;infection Vancomycin (NPC314743) NP level
NCT02865616 MET-2 Clinical Study for Recurrent Clostridium Difficile Infection (CDI) clostridium difficile infection Vancomycin (NPC314743) NP level
NCT00050401 Ventilator-Associated Pneumonia/Hospital-Acquired Pneumonia Requiring Mechanical Ventilatory Support pneumonia Vancomycin (NPC314743) NP level
NCT00003805 Prevention of Infection in Patients With Hematologic Cancer and Persistent Fever Caused by a Low White Blood Cell Count infection Vancomycin (NPC314743) NP level
NCT02600611 Phase 3 Study to Evaluate Safety and Efficacy of Iclaprim Versus Vancomycin for ABSSSI: REVIVE-1 infection Vancomycin (NPC314743) NP level
NCT01252732 Oritavancin Versus IV Vancomycin for the Treatment of Patients With Acute Bacterial Skin and Skin Structure Infection abscess;cellulitis;infection;inflammation Vancomycin (NPC314743) NP level
NCT03710122 Vancomycin for Primary Sclerosing Cholangitis sclerosing cholangitis Vancomycin (NPC314743) NP level
NCT02179658 A Study to Compare Safety and Efficacy of OPT-80(Fidaxomicin) With Vancomycin in Subjects With Clostridium Difficile-associated Diarrhea (CDAD) commensal Clostridium infectious disease Vancomycin (NPC314743) NP level
NCT03580122 The Effect of Arginine on Classic Galactosemia classic galactosemia Arginine (NPC226453) NP level
NCT01811732 Delafloxacin Versus Vancomycin and Aztreonam for the Treatment of Acute Bacterial Skin and Skin Structure Infections bacterial disease Vancomycin (NPC314743) NP level
NCT01594827 Persistent Methicillin Resistant Staphylococcus Aureus Eradication Protocol (PMEP) cystic fibrosis Vancomycin (NPC314743) NP level
NCT01263041 Effect of L-arginine and Glutamine on Preterm Sepsis Arginine (NPC226453) NP level
NCT00677339 L-arginine and Vitamin D Adjunctive Therapy in Pulmonary Tuberculosis (TB) pulmonary tuberculosis Arginine (NPC226453) NP level
NCT04802837 Safety, Tolerability and the Pharmacokinetics of Ridinilazole in Adolescent Subjects infection Vancomycin (NPC314743) NP level
NCT04025567 Vancomycin in Patients With Unresectable Fibrolamellar Hepatocellular Carcinoma (FLC) Oral hepatocellular carcinoma Vancomycin (NPC314743) NP level
NCT02466698 Intestinal Lavage for the Treatment of Severe C. Difficile Infections commensal Clostridium infectious disease Vancomycin (NPC314743) NP level
NCT01085760 A Pilot Study of Vancomycin or Metronidazole in Patients With Primary Sclerosing Cholangitis sclerosing cholangitis Vancomycin (NPC314743) NP level
NCT03759041 A Study to Assess Efficacy and Safety of SER-287 in Adults With Active Mild-to-Moderate Ulcerative Colitis ulcerative colitis Vancomycin (NPC314743) NP level
NCT01226992 Oral Vancomycin Followed by Fecal Transplant Versus Tapering Oral Vancomycin clostridium difficile infection Vancomycin (NPC314743) NP level
NCT01192828 Oxidative Stress Markers In Inherited Homocystinuria And The Impact Of Taurine homocystinuria Taurine (NPC300059) NP level
NCT00772447 China Registration Study in Patients With Skin Infections skin disease Vancomycin (NPC314743) NP level
NCT03462459 Efficacy of Oral Vancomycin Prophylaxis for Prevention of Recurrent Clostridium Difficile Infection clostridium difficile infection;Diarrhea Vancomycin (NPC314743) NP level
NCT01388764 Safety, Tolerability and Effects of L-Arginine in Boys With Dystrophinopathy on Corticosteroids Duchenne muscular dystrophy Arginine (NPC226453) NP level
NCT00571766 Effects of Oral L-Arginine on Chronic Hypertension in Pregnancy preeclampsia Arginine (NPC226453) NP level
NCT00770341 A Study of MK-3009 in Japanese Patients With Skin or Blood Stream Infections Caused by Methicillin-resistant Staphylococcus Aureus (MK-3009-002) Staphylococcus aureus infection Vancomycin (NPC314743) NP level
NCT00200746 Treatment of Alcohol-Related Hepatitis With Arginine Hepatitis, Alcoholic Arginine (NPC226453) NP level
NCT00006136 Phase II Study of Arginine Butyrate With or Without Epoetin Alfa in Patients With Thalassemia Intermedia Beta-thalassemia Arginine (NPC226453) NP level
NCT03595566 Comparison of Ridinilazole Versus Vancomycin Treatment for Clostridium Difficile Infection infection Vancomycin (NPC314743) NP level
NCT02374853 Topical Use of Vancomycin in Reducing Sternal Wound Infection in Cardiac Surgery (SWI Trial) infection Vancomycin (NPC314743) NP level
NCT03137173 Ceftobiprole in the Treatment of Patients With Acute Bacterial Skin and Skin Structure Infections infection Vancomycin (NPC314743) NP level
NCT01499277 Evaluation of Ceftaroline Fosamil Versus Vancomycin Plus Aztreonam in the Treatment of Patients With Skin Infections infection Vancomycin (NPC314743) NP level
NCT01816698 Effects and Safety of Taurine Granule on Blood Pressure in Prehypertensive hypertension Taurine (NPC300059) NP level
NCT01266018 Study of ADI-PEG 20 in Patients With Relapsed Sensitive or Refractory Small Cell Lung Cancer small cell lung carcinoma Arginine (NPC226453) NP level
NCT01975662 Vancomycin Versus Daptomycin for the Treatment of Methicillin Resistant Staphylococcus Aureus (MRSA) Bacteremia Staphylococcus aureus infection Vancomycin (NPC314743) NP level
NCT02426918 Study of Debio 1450 for Bacterial Skin Infections bacterial disease Vancomycin (NPC314743) NP level
NCT00269399 A Trial to Compare Xifaxan to Vancomycin for the Treatment of Clostridium Difficile-Associated Diarrhea (CDAD) commensal Clostridium infectious disease;Diarrhea Vancomycin (NPC314743) NP level
NCT05342272 Comparison of Gum® HydralTM Moisturizing Gel and Biotene® Oral Gel in Dry Mouth Sensation Reduction xerostomia Taurine (NPC300059) NP level
NCT02037295 Investigation of the Gut Microbiota in Regulating Nutrient Absorption in Humans obesity Vancomycin (NPC314743) NP level
NCT05256693 Prevention of C.Difficile Infections With Oral Vancomycine in Patients Undergoing Allogeneic Hematopoietic Stem Cell Transplant commensal Clostridium infectious disease Vancomycin (NPC314743) NP level
NCT04075526 Vancomycin Powder and Dilute Povidone Iodine Lavage for Infection Prophylaxis in High Risk Total Joint Arthroplasty osteoarthritis Vancomycin (NPC314743) NP level
NCT00616304 Safety and Preliminary Efficacy of L-arginine in Severe Falciparum Malaria Plasmodium falciparum malaria Arginine (NPC226453) NP level
NCT03088345 Early Use of Vasopressin in Post-Fontan Management congenital heart disease Arginine (NPC226453) NP level
NCT04968951 Refined Fecal Microbiota Transplantation (FMT) for Ulcerative Colitis (UC) ulcerative colitis Vancomycin (NPC314743) NP level
NCT03546829 Randomized Pilot Trial of Antimicrobial Therapy and Stereotactic Body Radiation Therapy in Early-stage Non-small Cell Lung Cancer non-small cell lung carcinoma Vancomycin (NPC314743) NP level
NCT02440061 Ghrelin and Beta Cell Function in Diabetes type 2 diabetes mellitus Arginine (NPC226453) NP level
NCT03964493 TNP-2092 to Treat Acute Bacterial Skin and Skin Structure Infection gram-positive bacterial infections Vancomycin (NPC314743) NP level
NCT00275418 Beta Carotene From Natural Source for Patients With Non-Active Crohn's Disease Crohn's disease Beta Carotene (NPC17810) NP level
NCT00426933 Phase 2 Safety and Efficacy Study of Daptomycin in Complicated Skin and Skin Structure Infections infection Vancomycin (NPC314743) NP level
NCT02801656 Fecal Microbiota Transplantation for Primary Clostridium Difficile Diarrhea commensal Clostridium infectious disease Vancomycin (NPC314743) NP level
NCT03640949 Vasopressin and Methylprednisolone for In-Hospital Cardiac Arrest sudden cardiac arrest Arginine (NPC226453) NP level
NCT00430937 Efficacy and Safety of Daptomycin Versus Vancomycin or Teicoplanin for Treatment of Complicated Skin and Soft Tissue Infections infection;skin disease Vancomycin (NPC314743) NP level
NCT01597505 Study of CB-183,315 in Participants With Clostridium Difficile Associated Diarrhea (MK-4261-005) clostridium difficile infection Vancomycin (NPC314743) NP level
NCT00000152 Randomized Trial of Beta-Carotene and Macular Degeneration macular degeneration Beta Carotene (NPC17810) NP level
NCT02618187 A Study to Evaluate the Safety, Tolerability and Microbiome Dynamics of SER-287 in Subjects With Mild-to-Moderate Ulcerative Colitis ulcerative colitis Vancomycin (NPC314743) NP level
NCT03861416 "Unifuzol®" in Patients With Peripheral Arterial Disease peripheral arterial disease Arginine (NPC226453) NP level
NCT00137124 L-Arginine Metabolism in Essential Hypertension essential hypertension Arginine (NPC226453) NP level
NCT02148601 Fecal Microbiota Transplantation by Colonoscopy for Recurrent C. Difficile Infection commensal Clostridium infectious disease Vancomycin (NPC314743) NP level
NCT01199783 Application of Daptomycin in MRSA Infected Diabetic Foot in Comparison to Vancomycin Treatment diabetic foot Vancomycin (NPC314743) NP level
NCT02516085 Improved Muscle Function in Duchenne Muscular Dystrophy Through L-Arginine and Metformin Duchenne muscular dystrophy Arginine (NPC226453) NP level
NCT01381354 Nutrition, Neuromuscular Electrical Stimulation (NMES) and Secondary Progressive Multiple Sclerosis (SPMS) multiple sclerosis Taurine (NPC300059) NP level
NCT03617445 Fecal Microbiota Transplantation for C. Difficile Infection in Solid Organ Transplant Recipients clostridium difficile infection Vancomycin (NPC314743) NP level
NCT04874012 Effect of Taurine on Glycemic, Lipid and Inflammatory Profile in Individuals With Type 2 Diabetes type 2 diabetes mellitus Taurine (NPC300059) NP level
NCT03673956 Topical Antibiotics in Chronic Rhinosinusitis sinusitis Vancomycin (NPC314743) NP level
NCT01764750 Dose Escalation Trial of Intrasite Vancomycin Pharmacokinetics infection Vancomycin (NPC314743) NP level
NCT04138706 Initial Vancomycin Taper for the Prevention of Recurrent Clostridium Difficile Infection clostridium difficile infection Vancomycin (NPC314743) NP level
NCT04775953 DOTS: Dalbavancin as an Option for Treatment of Staphylococcus Aureus Bacteremia bacteriemia Vancomycin (NPC314743) NP level
NCT00077675 Phase 2 Trial of TD-6424 (Telavancin) Versus Standard Therapy for Complicated Gram Positive Skin and Skin Structure Infections (Gram Positive cSSSI) infection Vancomycin (NPC314743) NP level
NCT01184872 Study to Compare Efficacy and Safety of Daptomycin in Elderly Patients With Complicated Skin and Soft Tissue Infections infection Vancomycin (NPC314743) NP level
NCT00945152 Effects of MRSA Bactericidal Gel To Promote Healing and Eliminate MRSA in cSSTI Vancogel(TM) bacterial disease Vancomycin (NPC314743) NP level
NCT00280683 Effects of L-arginine Supplementation in Adults With Moderate to Severe Asthma asthma Arginine (NPC226453) NP level
NCT00871104 Fosfomycin Plus Imipenem for Treatment of Infective Endocarditis infective endocarditis Vancomycin (NPC314743) NP level
NCT00107978 Comparison of Telavancin and Vancomycin for Complicated Skin and Skin Structure Infections With a Focus on Methicillin-resistant Staphylococcus Aureus staphylococcal skin infections Vancomycin (NPC314743) NP level
NCT02202135 Evaluation of Ceftaroline Fosamil vs Vancomycin Plus Aztreonam in the Treatment of Patients With Skin Infections. infection Vancomycin (NPC314743) NP level
NCT00344734 Effects of Acute L-NMMA Treatment on Renal Hemodynamics and Vasoactive Hormones in Patients With Congestive Heart Failure congestive heart failure Arginine (NPC226453) NP level
NCT01756924 Safety and Efficacy of CEM-102 With Rifampin Compared to Standard Therapy in Patients With Prosthetic Joint Infections or Spacer Infection infection Vancomycin (NPC314743) NP level
NCT04948814 Application of Fecal Microbiota Transplantation in Children With ASD autism spectrum disorder Vancomycin (NPC314743) NP level
NCT01570192 Clinical Trials to Reduce the Risk of Antimicrobial Resistance bacterial pneumonia Vancomycin (NPC314743) NP level
NCT00000541 Women's Antioxidant and Folic Acid Cardiovascular Study (WAFACS) myocardial infarction;Myocardial Ischemia Beta Carotene (NPC17810) NP level
NCT00513617 Effectiveness of Arginine as a Treatment for Sickle Cell Anemia sickle cell anemia Arginine (NPC226453) NP level
NCT01232595 Safety and Efficacy of Multiple Daily Dosing of Oral LFF571 in Patients With Moderate Clostridium Difficile Infections clostridium difficile infection Vancomycin (NPC314743) NP level
NCT00150852 Prevention of Gastrostomy-Related Wound Infection by Vancomycin in Carriers of Methicillin-Resistant Staphylococcus Aureus. infection Vancomycin (NPC314743) NP level
NCT04054973 L-arginine Study for Persistent Symptoms of Schizophrenia schizophrenia Arginine (NPC226453) NP level
NCT02276482 Study of Tedizolid Phosphate in Adolescents With Complicated Skin and Soft Tissue Infection (cSSTI) (MK-1986-012) skin disease Vancomycin (NPC314743) NP level
NCT01922011 Safety and Efficacy Study of Daptomycin Compared to Active Comparator in Pediatric Participants With Acute Hematogenous Osteomyelitis (AHO) (MK-3009-006) osteomyelitis Vancomycin (NPC314743) NP level
NCT02641236 Gut Decontamination In Pediatric Allogeneic Hematopoietic acute graft vs. host disease Vancomycin (NPC314743) NP level
NCT00108433 Linezolid in the Treatment of Hemodialysis Patients With Catheter-Related Gram-Positive Bloodstream Infections bacteriemia;gram-positive bacterial infections Vancomycin (NPC314743) NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

 How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
 ❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant
Association Type & Detailed Evidence
Bacterial infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1A00-1C4Z
 NCT04816968,NCT00423657,NCT01984684,NCT00945152,NCT01811732,NCT02426918,NCT01283581,NCT00424190
Pain, unspecified
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MG3Z
 TRPV1,CNR1,CNR2,ADRA2A
 NCT03446456,NCT01796678
Bacteraemia
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MA15.0
 NCT00108433,NCT02208063,NCT01191840,NCT01798537,NCT00037050,NCT04775953
Skin disease
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: EA00-EM0Z
 NCT00430937,NCT00772447,NCT00210899,NCT02276482,NCT00228410
Ulcerative colitis
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DD71
 NCT03759041,NCT04898348,NCT04968951,NCT05370885,NCT02618187
Sickle-cell disorder
Disease Category: 03.Diseases of the blood or blood-forming organs
Disease ICD-11 Code: 3A51
 NCT02447874,NCT00056433,NCT00513617,NCT05470998,NCT01142219
Diffuse large B-cell lymphomas
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A81
 CNR1,TSHR,BLM,CNR2,ADRA2A
Crohn disease
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DD70
 CNR2
 NCT02765256,NCT03476317,NCT00275418
Type 2 diabetes mellitus
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A11
 NFKB1,CNR1
 NCT02440061,NCT04874012
Gram-positive bacterial infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1B74-1F40
 NCT00037050,NCT00108433,NCT03964493,NCT00062647
Osteomyelitis or osteitis
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FB84
 NCT02344511,NCT01922011,NCT02099240,NCT00428844
Other specified pyogenic bacterial infection of skin and subcutaneous tissue
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1B7Y
 NCT01925066,NCT01975662,NCT00770341,NCT01792804
Staphylococcal/streptococcal disease
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1B5Y
 NCT00091819,NCT00442832,NCT00210899,NCT00107978
Adenocarcinoma of bronchus or lung
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25.0
 TSHR,SLCO1B1,ADRA2A,BLM
Rheumatoid arthritis
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FA20
 NFKB1,TRPV1
 NCT04535427
Atopic eczema
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: EA80
 NFKB1,TRPV1,CNR2
Chronic kidney disease
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GB61
 CNR1
 NCT00047983,NCT03452189
Pre-eclampsia
Disease Category: 18.Pregnancy, childbirth or the puerperium
Disease ICD-11 Code: JA24
 NCT00571766,NCT00974714,NCT00157521
Pulmonary hypertension
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BB01
 NCT00223717,NCT00345150,NCT01816698
Bacterial pneumonia
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CA40.0
 NCT00107952,NCT01570192,NCT00124020
Diarrhoea
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: ME05.1
 NCT00269399,NCT00314951,NCT03462459
Primary sclerosing cholangitis
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DB96.2
 NCT03710122,NCT01802073,NCT01085760
Malignant neoplasms of biliary tract, distal bile duct
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C15
 ADRA2A,BLM,CNR1
Leishmaniasis
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1F54
 CNR2,TSHR,BLM
Other specified malignant neoplasms of kidney, except renal pelvis
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C90.Y
 CNR1,TSHR,CNR1
Squamous cell carcinoma of bronchus or lung
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25.2
 TSHR,SLCO1B1,BLM
Mesothelioma of pleura
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C26.0
 CNR2,ADRA2A,CNR1
Germ cell tumour of testis
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C80.2
 CNR2,SLCO1B1,BLM
Clostridium difficile enterocolitis
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1A04
 NCT00384527,NCT03462459,NCT02801656,NCT02466698,NCT00269399,NCT02774382,NCT03827447,NCT05256693,NCT01226992,NCT02092935,NCT03030248,NCT03617445,NCT02743234,NCT02686645,NCT01983683,NCT02148601,NCT00314951,NCT04138706,NCT04247542,NCT03105479,NCT01222702,NCT02857582,NCT01232595,NCT02865616,NCT02179658,NCT01597505,NCT01987895,NCT03796650,NCT01598311
Herpes simplex infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1F00
 NCT01757236,NCT03595553,NCT02374853,NCT05320068,NCT00150852,NCT01764750,NCT04802837,NCT01339091,NCT04042077,NCT02600611,NCT04017468,NCT01984684,NCT00430937,NCT02607618,NCT00003805,NCT01499277,NCT01756924,NCT01184872,NCT02202135,NCT05266807,NCT03595566,NCT01252732,NCT00077675,NCT03137173,NCT04678154,NCT02227446,NCT00426933,NCT01400867
Insomnia
Disease Category: 07.Sleep-wake disorders
Disease ICD-11 Code: 7A00-7A0Z
 CNR2,CNR1
Asthma
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CA23
 TRPV1
 NCT00280683
Attention deficit hyperactivity disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6A05
 CNR2,ADRA2A
Inborn lipid metabolism error
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5C52
 CNR2,CNR1
Obesity
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5B80-5B81
 CNR1
 NCT02037295
Multiple sclerosis
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A40
 NFKB1
 NCT01381354
General pain disorder
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8E43
 CNR2,TRPV1
Osteoarthritis
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FA00-FA05
 TRPV1
 NCT04075526
Endocarditis
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BB40-BA42
 NCT00871104,NCT00695903
Bipolar disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6A60
 NCT00391001,NCT00217165
Cystic fibrosis
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CA25
 NCT01594827,NCT00405665
Diabetic foot ulcer
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BD54
 NCT05076955,NCT01199783
Pneumonia
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CA40
 NCT01798537,NCT00050401
Cardiovascular disease
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA00-BE2Z
 NCT03679780,NCT00408577
Autism spectrum disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6A02
 NCT04948814,NCT02504554
Hepatocellular carcinoma, NOS
Disease Category: X.Extension Codes
Disease ICD-11 Code: XH4W48
 NCT01287585,NCT04025567
Macular degeneration
Disease Category: 09.Diseases of the visual system
Disease ICD-11 Code: 9B75
 NCT00000152,NCT00000161
Bacterial cellulitis, erysipelas or lymphangitis
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1B70
 NCT01252732,NCT01339091
Hepatic fibrosis/cirrhosis
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DB93
 NCT00005107,NCT00344916
Pyogenic abscess of the skin
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1B75.3
 NCT01339091,NCT01252732
Dental caries
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DA08.0
 NCT02388178,NCT04750902
Duchenne muscular dystrophy
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C70.1
 NCT02516085,NCT01388764
Malaria
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1F40-1F45
 NCT00616304,NCT00147368
Pheochromocytoma
Disease Category: X.Extension Codes
Disease ICD-11 Code: XH3854
 BLM,ADRA2A
Hepatoblastoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C12.01
 BLM,CNR1
Adenocarcinoma of stomach
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B72.0
 SLCO1B1,BLM
Adenocarcinoma of pancreas
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C10.0
 CNR2,BLM
Hepatocellular carcinoma of liver
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C12.02
 BLM,CNR1
Malignant neoplasms of oesophagus
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B70
 SLCO1B1,BLM
Urothelial carcinoma of bladder
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C94.2
 SLCO1B1,BLM
Cytomegaloviral disease
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D82
 CNR2,CNR1
Malignant neoplasms of thymus
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C27
 NFKB1,CNR2
Invasive carcinoma of breast
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C61
 CNR2,BLM
Human immunodeficiency virus disease without mention of tuberculosis or malaria
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1C62
 CNR2,CNR1
Glioblastoma of brain
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00.00
 TSHR,BLM
Malignant neoplasms of adrenal gland
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D11
 BLM,ADRA2A
Acute/subacute hepatic failure
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DB91
 NFKB1
Diabetes mellitus, type unspecified
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A14
 NFKB1
Muscular dystrophy
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C70
 NFKB1
Solid tumour/cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00-2F9Z
 NFKB1
Depression
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6A70-6A7Z
 ADRA2A
Migraine
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A80
 TRPV1
Functional bladder disorder
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GC50
 TRPV1
Fungal infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1F29-1F2F
 NFKB1
Cannabis use disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6C41
 CNR1
Hypo-thyroidism
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A00
 TSHR
Acute diabete complication
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A2Y
 CNR1
Nausea/vomiting
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MD90
 CNR1
Opioid use disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6C43
 ADRA2A
Nicotine use disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6C4A
 CNR1
Lupus erythematosus
Disease Category: 04.Diseases of the immune system
Disease ICD-11 Code: 4A40
 NFKB1
Knee osteoarthritis
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FA01
 TRPV1
Indeterminate colitis
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DD72
 NFKB1
Acute myeloid leukaemia
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A60
 NFKB1
Colorectal cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B91
 CNR1
Irritable bowel syndrome
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DD91
 NFKB1
Choreiform disorder
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A01
 NFKB1
Anorexia nervosa
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6B80
 CNR1
Urinary tract infection
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GC08
 CNR1
Psoriasis
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: EA90
 NFKB1
Skin and skin-structure infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1F28-1G0Z
 NFKB1
Visual system disease
Disease Category: 09.Diseases of the visual system
Disease ICD-11 Code: 9E1Z
 TRPV1
Lower limb mononeuropathy
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C11
 TRPV1
Chronic pain
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MG30
 TRPV1
Thyroid cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D10
 TSHR
Substance abuse
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6C40
 ADRA2A
Metabolic disorder
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5C50-5D2Z
 CNR1
Other specified disorders of carbohydrate absorption or transport
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5C61.Y
 NCT02291458
Non-small cell lung cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25
 NCT03546829
Sepsis
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1G40-1G41
 NCT01263041
Mental/behavioural/neurodevelopmental disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6E20-6E8Z
 NCT00420823
coronary artery disease
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA8Y-BA8Z
 NCT00134433
COVID-19
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D6Y
 NCT04631536
Other specified conjunctivitis
Disease Category: 09.Diseases of the visual system
Disease ICD-11 Code: 9A60.Y
 NCT02432807
Argininosuccinic aciduria
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5C50.A0
 NCT00345605
Chronic rhinosinusitis
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CA0A
 NCT03673956
Allergic/hypersensitivity disorder
Disease Category: 04.Diseases of the immune system
Disease ICD-11 Code: 4A80-4A8Z
 NCT04249336
Prostate cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C82
 NCT01607879
Ischaemic heart diseases, unspecified
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA6Z
 NCT00000541
Malignant haematopoietic neoplasm
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B33
 NCT04983901
Chronic arterial occlusive disease, unspecified
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BD4Z
 NCT03861416
Graft-versus-host disease
Disease Category: 04.Diseases of the immune system
Disease ICD-11 Code: 4B24
 NCT02641236
Disorders of methionine cycle or sulphur amino acid metabolism
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5C50.B
 NCT01192828
Cataract
Disease Category: 09.Diseases of the visual system
Disease ICD-11 Code: 9B10
 NCT00000161
Neoplasms
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 02
 NCT01324115
Nosocomial
Disease Category: X.Extension Codes
Disease ICD-11 Code: XB25
 NCT01515020
Cardiac arrest
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MC82
 NCT03640949
Inflammatory arthropathy
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FA2Z
 NCT03506347
Periodontal disease
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DA0C
 NCT05042024
Beta thalassaemia
Disease Category: 03.Diseases of the blood or blood-forming organs
Disease ICD-11 Code: 3A50.2
 NCT00006136
Intermediate hyperglycaemia, unspecified
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A40.Z
 NCT02730962
Myocardial infarction
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA41-BA43
 NCT00000541
Xerostomia
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DA02.1
 NCT05342272
Mature T-cell lymphoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A90
 NCT00917826
Sepsis of fetus or newborn
Disease Category: 19.Certain conditions originating in the perinatal period
Disease ICD-11 Code: KA60
 NCT02790996
Essential hypertension
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA00
 NCT00137124
Pneumonia due to Staphylococcus
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CA40.06
 NCT01925066
Malignant neoplasm metastasis, unspecified
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2E2Z
 NCT03817125
Alcoholic hepatitis
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DB94.1
 NCT00200746
Ventilation associated with injury or harm in therapeutic use
Disease Category: 23.External causes of morbidity or mortality
Disease ICD-11 Code: PK81.0
 NCT00543608
Congestive heart failure
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BD10
 NCT00344734
Galactose-1-phosphate uridyltransferase deficiency
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5C51.40
 NCT03580122
Schizophrenia
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6A20
 NCT04054973
Melasma
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: ED60.1
 NCT01603446
Kidney failure
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GB60-GB6Z
 NCT02663596
Peritonitis
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DC50
 NCT03685747
Alzheimer disease
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A20
 NCT01439555
Tuberculosis of the respiratory system
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1B10
 NCT00677339
Glioblastoma, primary, NOS
Disease Category: X.Extension Codes
Disease ICD-11 Code: XH0MB1
 NCT02017249
Small cell carcinoma of bronchus or lung
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25.1
 NCT01266018
Constipation
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: ME05.0
 NCT02301221
Structural developmental anomaly of heart or great vessels, unspecified
Disease Category: 20.Developmental anomalies
Disease ICD-11 Code: LA8Z
 NCT03088345
NA
Disease Category: NA
Disease ICD-11 Code: NA
 NCT01252732
Carcinosarcoma of uterus
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C76.43
 TSHR
Coeliac disease
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DA95
 TSHR
Serous cystadenoma,borderline malignancy of ovary
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C73.4
 TSHR
Myelodysplastic syndromes, unspecified
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A3Z
 TSHR
Malignant neoplasm metastasis in lymph nodes of head, face or neck
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D60.0
 SLCO1B1
Myotonic dystrophy
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C71.0
 ADRA2A
West Nile virus infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D46
 NFKB1
Other specified malignant neoplasms ofcolon
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B90.Y
 SLCO1B1
Superficial ovarian endometriosis
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA10.B4
 ADRA2A
Adenocarcinoma of prostate
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C82.0
 SLCO1B1
Malignant neoplasms of stomach
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B72
 CNR1
Malignant neoplasms of corpus uteri, unspecified
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C76.Z
 BLM
Renal cell carcinoma, chromophobe type
Disease Category: X.Extension Codes
Disease ICD-11 Code: XH6153
 CNR1
Gliomas of brain
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00.0
 BLM

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network 
Data Section
Select to Download
1. General Info & Plant Usage & Geographical Distribution  
2. Plant Ingredients  
3. Collective Molecular Proteins  
4. Collective Enriched Activities  
5. Plant molecular targets overlapping with DEGs  
6. Associated clinical trials  
7. Associated Human Diseases  
>> Targets derived from weak experimental activities
About Us

The CMAUP database is developed by the Bioinformatics & Drug Design group (BIDD) and School of Pharmacy, Fudan University.

CMAUP

Home

About

Browse

Help

Useful links

BIDD home

NPASS database

TCM-ID database

TTD database

Contact

826 Zhangheng Road, Pudong New District, Shanghai, China

Principle Investigator:
Prof. Chen Yu Zong
chenyuzong@sz.tsinghua.edu.cn
Prof. Zeng Xian
zengxian@fudan.edu.cn

Developer & Maintainer:
Ph.D. Student Dongyue Hou
dyhou22@m.fudan.edu.cn
Mr. Hanbo Lin
hblin19@fudan.edu.cn
Ms. Yuhan Feng
yhfeng22@m.fudan.edu.cn

© 2023 Copyright: Bioinformatics & Drug Design group