CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Vicia Benghalensis

Example Image

PLANiTS DNA barcode

Click for details-----ITS

TCCATAGGTGAACCTGCGGAAGGATCATTGTCGATGCCTTACATGCAGTCCAACATGTGAATCAGTTTGAACACATACAGTGGACTTGGTGTTCCCCACCTGGGCCCACCTCTGGTTCGGAGGCGGACGGCGAAGTGCGTTCTCCTCCGAGCCAAAACTCAAACCCCGGCGCCGAATGCGTCAAGGAATTAAATTTTTGCTCTGAGAGCACCTGCATGGCATCGGAGACGGTTTTCGTGCGGGTTGTGTTTTGACACATGATATAGAATGACTCTCGGCAACGGATATCTAGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCTGATGCCATTAGGTTGAGGGCACGTCTGCCTGGGTGTCACATGTCGAAGCCTCCTTGACTATTGTGCAGGGTGGATGTTGGCCTCCCGTGAGCTCTTTCGTCTCATGGTTGGTTGAAAATCGAGTCCTTGGTAGGGTGTGCCATGATAGATGGTGGTTGTGTGACGCACGAGACCAACCATGCGCTTCTCTATTGTATTTGGCCTCTTTTACCCATATGCGTTTCTAAACGCTCGTG

Click for details-----ITS1

Click for details-----ITS2

GTCGAAGCCTCCTTGACTATTGTGCAGGGTGGATGTTGGCCTCCCGTGAGCTCTTTCGTCTCATGGTTGGTTGAAAATCGAGTCCTTGGTAGGGTGTGCCATGATAGATGGTGGTTGTGTGACGCACGAGACCAACCATGCGCTTCTCTATTGTATTTGGCCTCTTTTACCCATATGCGTTTCTAAACGCTCGTGA

Taxonomic Information

Plant ID: NPO19823
Plant Latin Name: Vicia Benghalensis
Taxonomy Genus: Vicia
Taxonomy Family: Fabaceae

Plant External Links:

NCBI TaxonomyDB: 154497
Plant-of-the-World-Online: 524572-1

Used in Medicines

Unknown.

Geographical Distribution

Australia; Italy; Portugal; Algeria; South Africa; Tunisia; Uruguay; France; Morocco; Austria; Chile; Greece; Kenya; Spain

Geographical Distribution

−

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

79 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

18 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

16 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC99574

Ingredient ID: NPC94223

Ingredient ID: NPC93515

Ingredient ID: NPC91416

Ingredient ID: NPC8932

Ingredient ID: NPC84301

Ingredient ID: NPC82770

Ingredient ID: NPC7126

Ingredient ID: NPC69768

Ingredient ID: NPC68673

Ingredient ID: NPC6674

Ingredient ID: NPC65424

Ingredient ID: NPC63441

Ingredient ID: NPC5473

Ingredient ID: NPC50583

Ingredient ID: NPC49984

Ingredient ID: NPC48800

Ingredient ID: NPC47262

Ingredient ID: NPC44326

Ingredient ID: NPC41750

Ingredient ID: NPC40775

Ingredient ID: NPC40701

Ingredient ID: NPC38714

Ingredient ID: NPC3251

Ingredient ID: NPC306464

Ingredient ID: NPC304477

Ingredient ID: NPC290924

Ingredient ID: NPC286347

Ingredient ID: NPC283849

Ingredient ID: NPC280300

Ingredient ID: NPC277168

Ingredient ID: NPC269108

Ingredient ID: NPC268848

Ingredient ID: NPC268747

Ingredient ID: NPC252334

Ingredient ID: NPC251881

Ingredient ID: NPC250550

Ingredient ID: NPC245712

Ingredient ID: NPC243728

Ingredient ID: NPC242800

Ingredient ID: NPC242611

Ingredient ID: NPC242563

Ingredient ID: NPC241807

Ingredient ID: NPC241631

Ingredient ID: NPC233238

Ingredient ID: NPC229821

Ingredient ID: NPC224757

Ingredient ID: NPC217579

Ingredient ID: NPC208894

Ingredient ID: NPC198991

Ingredient ID: NPC193956

Ingredient ID: NPC188815

Ingredient ID: NPC187724

Ingredient ID: NPC186083

Ingredient ID: NPC180579

Ingredient ID: NPC17740

Ingredient ID: NPC175069

Ingredient ID: NPC174537

Ingredient ID: NPC172742

Ingredient ID: NPC168064

Ingredient ID: NPC166709

Ingredient ID: NPC157868

Ingredient ID: NPC153758

Ingredient ID: NPC152044

Ingredient ID: NPC14665

Ingredient ID: NPC142661

Ingredient ID: NPC140707

Ingredient ID: NPC139891

Ingredient ID: NPC139060

Ingredient ID: NPC134810

Ingredient ID: NPC133671

Ingredient ID: NPC122415

Ingredient ID: NPC119501

Ingredient ID: NPC119434

Ingredient ID: NPC116775

Ingredient ID: NPC115162

Ingredient ID: NPC111929

Ingredient ID: NPC10931

Ingredient ID: NPC105751

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Show entries

Search:

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Cytochrome P450	Cytochrome P450 family 1	CYP1A2	Cytochrome P450 1A2	P05177	CHEMBL3356
Cytochrome P450	Cytochrome P450 family 1	CYP1B1	Cytochrome P450 1B1	Q16678	CHEMBL4878
Cytochrome P450	Cytochrome P450 family 1	CYP1A1	Cytochrome P450 1A1	P04798	CHEMBL2231
Cytochrome P450	Cytochrome P450 family 2	CYP2A6	Cytochrome P450 2A6	P11509	CHEMBL5282
Therapeutic Target	Lyase	CA12	Carbonic anhydrase XII	O43570	CHEMBL3242
Therapeutic Target	Lyase	CA2	Carbonic anhydrase II	P00918	CHEMBL205
Therapeutic Target	Lyase	CA7	Carbonic anhydrase VII	P43166	CHEMBL2326
Therapeutic Target	Lyase	CA14	Carbonic anhydrase XIV	Q9ULX7	CHEMBL3510
Therapeutic Target	Oxidoreductase	HSD17B2	Estradiol 17-beta-dehydrogenase 2	P37059	CHEMBL2789
Therapeutic Target	Structural protein	LMNA	Prelamin-A/C	P02545	CHEMBL1293235

Showing 1 to 10 of 11 entries

Previous1 2Next

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials

Clinical trial details

Show entries

Search:

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
No data available in table

Showing 0 to 0 of 0 entries

PreviousNext

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Show entries

Search:

Associated Disease of the Plant	Association Type & Detailed Evidence
Acquired hypermelanosis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: ED60	TYR
Acquired hypomelanotic disorder Disease Category: 14.Diseases of the skin Disease ICD-11 Code: ED63	TYR
Acute diabete complication Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A2Y	DPP4
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	CA7,CA12,CYP2C9
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	CYP1B1,CA2,CYP2C9,CISD1,DPP4,CA7,CA14,LMNA,HSD17B2
Atopic eczema Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA80	AHR
Atrial fibrillation Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BC81.3	CA7
Autism spectrum disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A02	DPP4
Bacterial infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1A00-1C4Z	CA12,CYP2C9,CA14,CA2
Breast cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C60-2C6Y	CA2,CA12,CA14

Showing 1 to 10 of 73 entries

Previous1 2 3 4 5…8Next

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Vicia Benghalensis

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

79 All known Ingredients in Total

18 Ingredients with Acceptable Bioavailablity

16 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Acquired hypermelanosis

Acquired hypomelanotic disorder

Acute diabete complication

Adenocarcinoma of bronchus or lung

Adenocarcinoma of pancreas

Atopic eczema

Atrial fibrillation

Autism spectrum disorder

Bacterial infection

Breast cancer

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

>> Targets derived from weak experimental activities