CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Loropetalum Chinense

Example Image

PLANiTS DNA barcode

Click for details-----ITS

TCGAAACCTGCACAGCAGAACGACCCGCGAACNTGTATANNCGCCAGTCGGGGCGGGGGGGAGTTCGCCCTCGTCTCACCCCCAAAGTCGGGACGCGCTCGGTGCTCGGTCCGCGACCCGTGCCACGTGCTCGGGAAGCCNNGGTCCCCGTCGTGCTCTCGATCTCACAACGAACCCCGGCGCAAAACGCGTCAAGGAATCTCAATACAAGAGCGTGCTCCCATCCCCCGGTCACGGGTGCCGGTGGGGGCAATCGCTTCTTCGATATTATTCTAAACGACTCTCGGCAACGGATATCTCGCGTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCNNNNNNNNNNNNNNNNNNNGAACGCAAGTTGCGCCCAAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCCAACCCTTCCCACGCACGCCGTGGTGATGGGCGCCATGCGGGGGCGGAGATTGGCCTCCCGTGCACCGCGCTGCGGTTGGCCTAAAAACGAGCCCCGGGCGGCAGAACGTCACGATGAGTGGTGGTTTACAAGCCCCGATCCGGAAACGTGTCGTGTCGTGCGTTGCACTGTCGCCCGCTGGAGCCACGAGACCCCGATGCGCCGCAACCACGGTGCTTCCA

Click for details-----ITS1

Click for details-----ITS2

ATCGCGTCGCCCCCCCAACCCTTCCCACGCACGCMGTGGTGATGGGCGCCATGCGGGGGCGGAGATTGGCCTCCCGTGCACCGCGCTGCGTTGGCCTAAAAACGAGCCCCGGCGGCAGAACGTCACGATAAGTGGTGGTTTACAAGCCCCGATCCGGAAACGTGTCGTGTCGTGCGTTGCACTGTCGCCCGCCGGAGCCACGAGACCCCGATGCGCNGCAACCACGGTGCTTCCATCGCGACCCCAGGTCAGGCGGGA

Taxonomic Information

Plant ID: NPO18881
Plant Latin Name: Loropetalum Chinense
Taxonomy Genus: Loropetalum
Taxonomy Family: Hamamelidaceae

Plant External Links:

NCBI TaxonomyDB: 64118
Plant-of-the-World-Online: 430722-1

Used in Medicines

Country/Region:

China

Traditional Medicine System:

TCM

Medicinal Functions:

Depurative; Haemostatic; Pectoral

Geographical Distribution

Japan; Taiwan; China

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

38 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

27 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

16 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC97766

Ingredient ID: NPC9519

Ingredient ID: NPC95003

Ingredient ID: NPC92148

Ingredient ID: NPC86930

Ingredient ID: NPC83831

Ingredient ID: NPC71357

Ingredient ID: NPC67840

Ingredient ID: NPC65448

Ingredient ID: NPC64642

Ingredient ID: NPC52197

Ingredient ID: NPC5219

Ingredient ID: NPC47844

Ingredient ID: NPC309399

Ingredient ID: NPC302857

Ingredient ID: NPC296390

Ingredient ID: NPC285675

Ingredient ID: NPC28274

Ingredient ID: NPC265513

Ingredient ID: NPC259190

Ingredient ID: NPC225710

Ingredient ID: NPC220596

Ingredient ID: NPC219573

Ingredient ID: NPC21820

Ingredient ID: NPC216460

Ingredient ID: NPC209093

Ingredient ID: NPC196776

Ingredient ID: NPC193770

Ingredient ID: NPC176803

Ingredient ID: NPC176751

Ingredient ID: NPC149455

Ingredient ID: NPC142703

Ingredient ID: NPC126940

Ingredient ID: NPC126852

Ingredient ID: NPC125226

Ingredient ID: NPC123990

Ingredient ID: NPC110126

Ingredient ID: NPC106567

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Therapeutic Target	Enzyme	KARS1	Lysyl-tRNA synthetase	Q15046	CHEMBL5575
Therapeutic Target	Lysine demethylase	KDM4E	Lysine-specific demethylase 4D-like	B2RXH2	CHEMBL1293226
Therapeutic Target	Structural protein	LMNA	Prelamin-A/C	P02545	CHEMBL1293235
Therapeutic Target	Transferase	FUT7	Alpha-(1,3)-fucosyltransferase 7	Q11130	CHEMBL3596077

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials
NP level	6

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT02621060	Effect of Chlorogenic Acid on Patients With Impaired Glucose Tolerance	abnormal glucose tolerance	Chlorogenic Acid (NPC302857)	NP level
NCT02136342	Phase 1 Trial of Chlorogenic Acid in Patients With Advanced Cancer	cancer	Chlorogenic Acid (NPC302857)	NP level
NCT03758014	Studies of Chlorogenic Acid for Injection for Safety and Efficacy of Grade IV GBM Patients	glioblastoma multiforme	Chlorogenic Acid (NPC302857)	NP level
NCT02728349	Tolerance and Pharmacokinetic Study of Chlorogenic Acid to Advanced Glioblastoma	glioblastoma multiforme	Chlorogenic Acid (NPC302857)	NP level
NCT02245204	Phase I Studies of Chlorogenic Acid for Injection for Tolerance and Pharmacokinetic of Advanced Cancers	cancer	Chlorogenic Acid (NPC302857)	NP level
NCT03751592	Phase Ib/IIa Studies of Chlorogenic Acid for Injection for Safety and Efficacy of Advanced Lung Cancer	lung cancer	Chlorogenic Acid (NPC302857)	NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	AKR1B1,TDP1,FUT7,HSD17B10
Diffuse large B-cell lymphomas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	TDP1,AKR1B1,HSD17B10,LMNA
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	TDP1,FUT7,LMNA
Malignant neoplasms of thymus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C27	AKR1B1,FUT7,HSD17B10
Unspecified malignant neoplasms of unspecified sites Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D4Z	NCT02245204,NCT02136342
Glioblastoma, primary, NOS Disease Category: X.Extension Codes Disease ICD-11 Code: XH0MB1	NCT02728349,NCT03758014
Serous cystadenoma,borderline malignancy of ovary Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73.4	TDP1,FUT7
Malignant neoplasms of biliary tract, distal bile duct Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C15	LMNA,AKR1B1
Leishmaniasis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F54	AKR1B1,FUT7
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	FUT7,LMNA
Germ cell tumour of testis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80.2	AKR1B1,FUT7
Insomnia Disease Category: 07.Sleep-wake disorders Disease ICD-11 Code: 7A00-7A0Z	CYP2D6
Glaucoma Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9C61	AKR1B1
Neuropathy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C0Z	AKR1B1
Cataract Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9B10	AKR1B1
Acute diabete complication Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A2Y	AKR1B1
Rheumatoid arthritis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA20	AKR1B1
Schizophrenia Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A20	AKR1B1
Pain, unspecified Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG3Z	AKR1B1
Malaria Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F40-1F45	CYP2D6
Thrombosis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB61-GB90	AKR1B1
Lung cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25	NCT03751592
Impaired glucose tolerance Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A40.1	NCT02621060
Pheochromocytoma Disease Category: X.Extension Codes Disease ICD-11 Code: XH3854	FUT7
Hepatoblastoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.01	AKR1B1
Other specified malignant neoplasms of kidney, except renal pelvis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90.Y	FUT7
Melanoma of skin Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C30	FUT7
Superficial ovarian endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10.B4	LMNA
Urothelial carcinoma of bladder Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C94.2	AKR1B1
Cytomegaloviral disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D82	KDM4E
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	CYP2D6
Malignant neoplasms of corpus uteri, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.Z	CYP2D6
Chikungunya virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D40	LMNA
Polycystic ovary syndrome Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A80.1	FUT7
Invasive carcinoma of breast Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C61	FUT7
Glioblastoma of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.00	LMNA
Carpal tunnel syndrome Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C10.0	FUT7
Malignant neoplasms of adrenal gland Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D11	FUT7

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Loropetalum Chinense

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

Country/Region:

Traditional Medicine System:

Medicinal Functions:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

38 All known Ingredients in Total

27 Ingredients with Acceptable Bioavailablity

16 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Carcinosarcoma of uterus

Diffuse large B-cell lymphomas

Mesothelioma of pleura

Malignant neoplasms of thymus

Unspecified malignant neoplasms of unspecified sites

Glioblastoma, primary, NOS

Serous cystadenoma,borderline malignancy of ovary

Malignant neoplasms of biliary tract, distal bile duct

Leishmaniasis

Adenocarcinoma of pancreas

Germ cell tumour of testis

Insomnia

Glaucoma

Neuropathy

Cataract

Acute diabete complication

Rheumatoid arthritis

Schizophrenia

Pain, unspecified

Malaria

Thrombosis

Lung cancer

Impaired glucose tolerance

Pheochromocytoma

Hepatoblastoma

Other specified malignant neoplasms of kidney, except renal pelvis

Melanoma of skin

Superficial ovarian endometriosis

Urothelial carcinoma of bladder

Cytomegaloviral disease

Adenocarcinoma of bronchus or lung

Malignant neoplasms of corpus uteri, unspecified

Chikungunya virus disease

Polycystic ovary syndrome

Invasive carcinoma of breast

Glioblastoma of brain

Carpal tunnel syndrome

Malignant neoplasms of adrenal gland

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

>> Targets derived from weak experimental activities