• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Sambucus Williamsii


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAAACCTGCACAGCAGAATGACCCGCGAACTCGTTTTCATATTGGGGCTCGTCGGCCTAGGTGCGCAAGTGCTTGGCCGRCGAACTTCGGTCAGGGCGCCCTCGGTGTGCTGACCAAACAATGAACCCCGGCGCGAACTGCGCCAAGGAATTTTTACTGAAGAGCGTGTCTATCGTTGCCCCGTTCGCGGTGTGCACGGTAGGCCTGCGCCTTTGAAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAATGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAATGCAAGTTGCGCCCGAGGCCATTAGGTCGAGGGCACGTCTGCCTGGGCGTCACACATTGCCGTCGCCCCCTTCCAATTTCCCATTCTTGGGGACGTTGGTAGTCGGGCGGATATTGGTCTCCCGTGCTCTCGAGCGCGGTTGGCCCAAAAGCGAGTCCCCGACAACGGACGTCATGACAAGTGGTGGTTGAAAAGCCTTCTTATCCTGTCGTGCACCAATTCGTTGTCACGGGCATCGAGTTGACCCTGACGCGTCGTCTCTGACGTCGCTCCGATCGCGACCCCAG

Click for details-----ITS1

CTTACTGATTGTATGATGATGTGAGAGAGACCTGCACAGCAGAATGACCCGCGAACTCGTTTTCATATTGGGGCTCGTCGGCCTAGGTGCGCAAGTGCTTGGCCGACGAACTTCGGTCAGGGTGCCCTCGGTGTGCTGACCAAACAATGAACCCCGGCGCGAACTGCGCCAAGGAATTTTTACTGAAGAGCGTGTCTATTGTTGCCCCGTTCGCGGTGTGCACGGTAGGCCTGCGCCTTTGAAACACAAA

Click for details-----ITS2

AAATGCCGTCTCCCCCTTCCCATTTCTCATTCTTGGGGACGTTGGTAGTCGGGCGGATATTGGTCTCCCGTGCTCTCGAGCGCGGTTGGCCCAAAAGCGAGTCCCCGACAACGGACGTCATGACAAGTGTTGGTTGAAAAGCCATCTTATCCTGTCGTGCACCTCTTCGTTGTCACGGGCATCGAGTTGACCCTGACGCGTCGTCTCTGACGTCGAGTTCGA
Taxonomic Information

Plant ID: NPO17434
Plant Latin Name: Sambucus Williamsii
Taxonomy Genus: Sambucus
Taxonomy Family: Adoxaceae

Plant External Links:

NCBI TaxonomyDB: 180062
Plant-of-the-World-Online: n.a.

Used in Medicines

Unknown.

Geographical Distribution
Geographical Distribution
+
−
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

47 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


37 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

34 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC95615

Ingredient ID: NPC78918

Ingredient ID: NPC48736

Ingredient ID: NPC485398

Ingredient ID: NPC485397

Ingredient ID: NPC485396

Ingredient ID: NPC485395

Ingredient ID: NPC485394

Ingredient ID: NPC40432

Ingredient ID: NPC38059

Ingredient ID: NPC34103

Ingredient ID: NPC3295

Ingredient ID: NPC319929

Ingredient ID: NPC311256

Ingredient ID: NPC307050

Ingredient ID: NPC29799

Ingredient ID: NPC286620

Ingredient ID: NPC273709

Ingredient ID: NPC263367

Ingredient ID: NPC257582

Ingredient ID: NPC23962

Ingredient ID: NPC23646

Ingredient ID: NPC230124

Ingredient ID: NPC228346

Ingredient ID: NPC219913

Ingredient ID: NPC214001

Ingredient ID: NPC202826

Ingredient ID: NPC187998

Ingredient ID: NPC185498

Ingredient ID: NPC178970

Ingredient ID: NPC165159

Ingredient ID: NPC164778

Ingredient ID: NPC161557

Ingredient ID: NPC158079

Ingredient ID: NPC156502

Ingredient ID: NPC153572

Ingredient ID: NPC148842

Ingredient ID: NPC143709

Ingredient ID: NPC141765

Ingredient ID: NPC139617

Ingredient ID: NPC131046

Ingredient ID: NPC126409

Ingredient ID: NPC115207

Ingredient ID: NPC114171

Ingredient ID: NPC113961

Ingredient ID: NPC111888

Ingredient ID: NPC10737

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM
Target Type: Individual Protein of Homo sapiens
*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.
.

Detailed Information of Target Proteins

Target TypeProtein ClassGene IDProtein NameUniprot IDTarget ChEMBL ID
Therapeutic Target Enzyme NOS1 Nitric-oxide synthase, brain P29475 CHEMBL3568
Therapeutic Target Enzyme NOS3 Nitric-oxide synthase, endothelial P29474 CHEMBL4803
Therapeutic Target Histone acetyltransferase NCOA3 Nuclear receptor coactivator 3 Q9Y6Q9 CHEMBL1615382
Therapeutic Target Isomerase TOP2B DNA topoisomerase II beta Q02880 CHEMBL3396
Therapeutic Target Nuclear hormone receptor subfamily 3 ESR2 Estrogen receptor beta Q92731 CHEMBL242
Therapeutic Target Nuclear hormone receptor subfamily 3 ESR1 Estrogen receptor alpha P03372 CHEMBL206
Therapeutic Target Transient receptor potential channel TRPV1 Vanilloid receptor Q8NER1 CHEMBL4794
Showing 1 to 7 of 7 entries
Previous1Next
Clinical Trials Summary
Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type Number of clinical trials
NP level978
Clinical trial details
NCT IDTitleConditionForm in clinical useAssociated by plant or compound
NCT00000660 Phase I Study of Weekly Oral VP-16 for AIDS-Associated Kaposi's Sarcoma Kaposi's sarcoma Etoposide (NPC185498) NP level
NCT00001339 A Study of Combination Chemotherapy and Surgical Resection in the Treatment of Adrenocortical Carcinoma: Continuous Infusion Doxorubicin, Vincristine and Etoposide With Daily Mitotane Before and After Surgical Resection carcinoma Etoposide (NPC185498) NP level
NCT00001563 EPOCH Chemotherapy +/- IL-12 for Previously Untreated and EPOCH Plus Rituximab for Previously Treated Patients With AIDS-Associated Lymphoma Lymphoma, AIDS-Related Etoposide (NPC185498) NP level
NCT00002461 Combination Chemotherapy Followed by Bone Marrow or Peripheral Stem Cell Transplantation in Treating Patients With Refractory Hodgkin's Disease or Non-Hodgkin's Lymphoma lymphoma Etoposide (NPC185498) NP level
NCT00002471 Combination Chemotherapy in Treating Patients With Acute B-Lymphoblastic Leukemia or Non-Hodgkin's Lymphoma leukemia;lymphoma Etoposide (NPC185498) NP level
NCT00002481 Combination Chemotherapy and Radiation Therapy Plus Bone Marrow Transplantation in Treating Patients With Relapsed or Refractory Non-Hodgkin's Lymphoma lymphoma Etoposide (NPC185498) NP level
NCT00002488 Combination Chemotherapy in Treating Patients With Intermediate-Grade or High-Grade Non-Hodgkin's Lymphoma Who Have Not Responded to Anthracycline-Containing Combination Chemotherapy lymphoma Etoposide (NPC185498) NP level
NCT00002494 Combination Chemotherapy in Treating Patients With Non-Hodgkin's Lymphoma or Acute Lymphocytic Leukemia leukemia;lymphoma Etoposide (NPC185498) NP level
NCT00002509 High-Dose Combination Chemotherapy Followed by Peripheral Stem Cell Transplantation in Treating Patients With Poor-Prognosis Breast Cancer breast cancer Etoposide (NPC185498) NP level
NCT00002510 Chemotherapy and Radiation Therapy Followed by Peripheral Stem Cell Transplantation in Treating Patients With Non-Hodgkin's Lymphoma lymphoma Etoposide (NPC185498) NP level
Showing 1 to 10 of 978 entries
Previous12345…98Next

❱❱❱ Associated Human Diseases and Detailed Association Evidence

 How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant
Association Type & Detailed Evidence
Acne vulgaris
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: ED80
 ESR1
Acquired prion disease
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8E01
 ESR1
Acute basophilic leukaemia
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A60.37
 NCT00006363,NCT00369317
Acute erythroid leukaemia
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A60.35
 NCT00006363,NCT00003190,NCT00002798,NCT00369317
Acute megakaryoblastic leukaemia
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A60.36
 NCT00369317,NCT00002798,NCT00006363,NCT00003190
Acute monocytic leukaemia
Disease Category: X.Extension Codes
Disease ICD-11 Code: XH9NE2
 NCT00006363,NCT00369317,NCT00002798,NCT00003190
Acute myeloid leukaemia
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A60
 TOP2B
 NCT00002798,NCT00151242,NCT00369317,NCT02421939,NCT02773732,NCT00186966,NCT00780104,NCT00512252,NCT01729845,NCT00003190,NCT03926624,NCT01027923,NCT01411267,NCT02638428,NCT03860844,NCT01025778,NCT03568994,NCT02626338,NCT00660036,NCT00880243,NCT03118466,NCT03182244,NCT00003190,NCT00906945,NCT03591510,NCT02070458,NCT00079482,NCT00151255,NCT00315705,NCT03504410,NCT00006363,NCT03164057,NCT00939653,NCT04326439,NCT01237808,NCT01681537,NCT03839446,NCT00703820,NCT00774046,NCT03793478,NCT02631252,NCT02349178,NCT02039726,NCT02306291,NCT02400281,NCT01677949,NCT04293562,NCT00136084,NCT01180322,NCT00146120,NCT02632708,NCT01830777,NCT02848183
Acute myelomonocytic leukaemia
Disease Category: X.Extension Codes
Disease ICD-11 Code: XH78Y4
 NCT00369317,NCT00002798,NCT00003190,NCT00006363
Adenocarcinoma of pancreas
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C10.0
 CASP3,NOS2
Adenocarcinoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D40
 NCT01958372,NCT00020709,NCT00042835
Showing 1 to 10 of 216 entries
Previous12345…22Next

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network 
Data Section
Select to Download
1. General Info & Plant Usage & Geographical Distribution  
2. Plant Ingredients  
3. Collective Molecular Proteins  
4. Collective Enriched Activities  
5. Plant molecular targets overlapping with DEGs  
6. Associated clinical trials  
7. Associated Human Diseases  
>> Targets derived from weak experimental activities
About Us

The CMAUP database is developed by the Bioinformatics & Drug Design group (BIDD) and School of Pharmacy, Fudan University.

CMAUP

Home

About

Browse

Help

Useful links

BIDD home

NPASS database

TCM-ID database

TTD database

Contact

826 Zhangheng Road, Pudong New District, Shanghai, China

Principle Investigator:
Prof. Chen Yu Zong
chenyuzong@sz.tsinghua.edu.cn
Prof. Zeng Xian
zengxian@fudan.edu.cn

Developer & Maintainer:
Ph.D. Student Dongyue Hou
dyhou22@m.fudan.edu.cn
Mr. Hanbo Lin
hblin19@fudan.edu.cn
Ms. Yuhan Feng
yhfeng22@m.fudan.edu.cn

© 2023 Copyright: Bioinformatics & Drug Design group