• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Eucalyptus Radiata


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

GACCAGAGAACCGGTAACAAACTCAACGGGGGCGGCGGGCTCWGCCCGACGTCCCCCTCGACGCCGAGGATTTGGCTCGGGCGCCCCAGGGCGCTCGGCCCSGTCCTCGGCGGCGCAACGAACCCCGGCGCGGAATGCGCCAAGGAACTTGAACAAGAGTGCGATGCTCCCGCCRCCCCATACACGGTGCGCGCGCGGGATGCCATGCAATCTCATATTAGTCATAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO1715
Plant Latin Name: Eucalyptus Radiata
Taxonomy Genus: Eucalyptus
Taxonomy Family: Myrtaceae

Plant External Links:

NCBI TaxonomyDB: 87679
Plant-of-the-World-Online: 593296-1

Used in Medicines

Unknown.

Geographical Distribution

Australia

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

25 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


13 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

9 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC87125

Ingredient ID: NPC79589

Ingredient ID: NPC76336

Ingredient ID: NPC66414

Ingredient ID: NPC39793

Ingredient ID: NPC311485

Ingredient ID: NPC294852

Ingredient ID: NPC286619

Ingredient ID: NPC286006

Ingredient ID: NPC280249

Ingredient ID: NPC264640

Ingredient ID: NPC253915

Ingredient ID: NPC230301

Ingredient ID: NPC228569

Ingredient ID: NPC226712

Ingredient ID: NPC220490

Ingredient ID: NPC204932

Ingredient ID: NPC185721

Ingredient ID: NPC176869

Ingredient ID: NPC169828

Ingredient ID: NPC147150

Ingredient ID: NPC147001

Ingredient ID: NPC130235

Ingredient ID: NPC113744

Ingredient ID: NPC110532