CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Phonus Arborescens

Example Image

PLANiTS DNA barcode

TCGAAGCCTGCATAGCAGAACGACCCGTGAACATGTAATCAAAACCGGGTGTTGTGGGATTGGGTGTGAGCCTTAGCCCTACGATGCTCGCTGGCATGCGTGTAAGGTGCCTATCTCTAGGCATCGTGGACGTTGTGCCGGCACAAAAACAAACCCCGGCACGGCATGTGCCAAGGAAAACAAAACTCAAGAAGGGTGCGTCTCGTGTTGCCTCGTTTTCGGTGTACACACGGGTCGTGGCCTCTCATTAACCATAAA

Click for details-----ITS2

Taxonomic Information

Plant ID: NPO16885
Plant Latin Name: Phonus Arborescens
Taxonomy Genus: Phonus
Taxonomy Family: Asteraceae

Plant External Links:

NCBI TaxonomyDB: 121177
Plant-of-the-World-Online: n.a.

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

57 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

54 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

16 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC96670

Ingredient ID: NPC93729

Ingredient ID: NPC89432

Ingredient ID: NPC86189

Ingredient ID: NPC72622

Ingredient ID: NPC70380

Ingredient ID: NPC70036

Ingredient ID: NPC68233

Ingredient ID: NPC64061

Ingredient ID: NPC60120

Ingredient ID: NPC51371

Ingredient ID: NPC51106

Ingredient ID: NPC48641

Ingredient ID: NPC43665

Ingredient ID: NPC42372

Ingredient ID: NPC41409

Ingredient ID: NPC39325

Ingredient ID: NPC309198

Ingredient ID: NPC303187

Ingredient ID: NPC292859

Ingredient ID: NPC291450

Ingredient ID: NPC289751

Ingredient ID: NPC282017

Ingredient ID: NPC278499

Ingredient ID: NPC278434

Ingredient ID: NPC278228

Ingredient ID: NPC267732

Ingredient ID: NPC26734

Ingredient ID: NPC265310

Ingredient ID: NPC262908

Ingredient ID: NPC257239

Ingredient ID: NPC245511

Ingredient ID: NPC244028

Ingredient ID: NPC237156

Ingredient ID: NPC232451

Ingredient ID: NPC229197

Ingredient ID: NPC229087

Ingredient ID: NPC226643

Ingredient ID: NPC222439

Ingredient ID: NPC218465

Ingredient ID: NPC214702

Ingredient ID: NPC201451

Ingredient ID: NPC195964

Ingredient ID: NPC194432

Ingredient ID: NPC19000

Ingredient ID: NPC188646

Ingredient ID: NPC183544

Ingredient ID: NPC172572

Ingredient ID: NPC172259

Ingredient ID: NPC1704

Ingredient ID: NPC169922

Ingredient ID: NPC152114

Ingredient ID: NPC126739

Ingredient ID: NPC120301

Ingredient ID: NPC116698

Ingredient ID: NPC105258

Ingredient ID: NPC104307

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Cytochrome P450	Cytochrome P450 family 19	CYP19A1	Cytochrome P450 19A1	P11511	CHEMBL1978
Therapeutic Target	Small molecule receptor (family A GPCR)	HCAR2	Hydroxycarboxylic acid receptor 2	Q8TDS4	CHEMBL3785

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	CYP19A1,HCAR2
West Nile virus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D46	CYP19A1,HCAR2
Hepatocellular carcinoma of liver Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.02	CYP19A1,CYP19A1
Glioblastoma of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.00	CYP19A1,HCAR2
Hyper-lipoproteinaemia Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C80	HCAR2
Cardiovascular disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA00-BE2Z	HCAR2
Chronic arterial occlusive disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD4Z	HCAR2
Neuropathy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C0Z	CYP19A1
Dyslipidemia Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C80-5C81	HCAR2
Endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10	CYP19A1
Cerebral ischaemic stroke Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B11	HCAR2
Oesophagitis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA24	CYP19A1
Inborn lipid metabolism error Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C52	HCAR2
Breast cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C60-2C6Y	CYP19A1
Cushing syndrome Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A70	CYP19A1
Crohn disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD70	HCAR2
Coeliac disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA95	HCAR2
Serous cystadenoma,borderline malignancy of ovary Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73.4	HCAR2
Inflammatory bowel diseases, unspecified Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD7Z	HCAR2
Hepatoblastoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.01	CYP19A1
Adenocarcinoma of stomach Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72.0	CYP19A1
Other specified malignant neoplasms of kidney, except renal pelvis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90.Y	CYP19A1
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	HCAR2
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	HCAR2
Other specified malignant neoplasms ofcolon Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B90.Y	HCAR2
Malignant neoplasms of thyroid gland, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D10.Z	HCAR2
Malignant neoplasms of corpus uteri, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.Z	HCAR2
Chikungunya virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D40	CYP19A1
Malignant neoplasms of thymus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C27	HCAR2
Malaria, unspecified Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F4Z	HCAR2
Renal cell carcinoma, chromophobe type Disease Category: X.Extension Codes Disease ICD-11 Code: XH6153	HCAR2
Ebola virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D60.01	HCAR2
Malignant neoplasms of adrenal gland Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D11	CYP19A1
Lyme borreliosis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1C1G	HCAR2

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Phonus Arborescens

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

57 All known Ingredients in Total

54 Ingredients with Acceptable Bioavailablity

16 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Carcinosarcoma of uterus

West Nile virus infection

Hepatocellular carcinoma of liver

Glioblastoma of brain

Hyper-lipoproteinaemia

Cardiovascular disease

Chronic arterial occlusive disease

Neuropathy

Dyslipidemia

Endometriosis

Cerebral ischaemic stroke

Oesophagitis

Inborn lipid metabolism error

Breast cancer

Cushing syndrome

Crohn disease

Coeliac disease

Serous cystadenoma,borderline malignancy of ovary

Inflammatory bowel diseases, unspecified

Hepatoblastoma

Adenocarcinoma of stomach

Other specified malignant neoplasms of kidney, except renal pelvis

Adenocarcinoma of pancreas

Mesothelioma of pleura

Other specified malignant neoplasms ofcolon

Malignant neoplasms of thyroid gland, unspecified

Malignant neoplasms of corpus uteri, unspecified

Chikungunya virus disease

Malignant neoplasms of thymus

Malaria, unspecified

Renal cell carcinoma, chromophobe type

Ebola virus disease

Malignant neoplasms of adrenal gland

Lyme borreliosis

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

>> Targets derived from weak experimental activities