CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Pittosporum Tobira

Example Image

PLANiTS DNA barcode

ATCGCATCGCCCCCATCCCTCCCCATCCCATTAGGGGTATCGAGGGCGGGGGGGCGGATATTGGCCTCCCGTGCCTCTTGATGTGCGGTTGGCCCAAATGCGAGTCCTCGGCGACGTACGTCACGACAAGTGGTGGTTGTTAAAGGCCCTCTTATCATGTCATGTGGTCAAATGCCGCCAGAGCGATCTCATGTGACCCTGTTGTGCCGTCCCTGACGGTGTGCTCCGA

Taxonomic Information

Plant ID: NPO16793
Plant Latin Name: Pittosporum Tobira
Taxonomy Genus: Pittosporum
Taxonomy Family: Pittosporaceae

Plant External Links:

NCBI TaxonomyDB: 43073
Plant-of-the-World-Online: n.a.

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

5 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

5 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

3 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC28657

Ingredient ID: NPC230301

Ingredient ID: NPC161193

Ingredient ID: NPC134847

Ingredient ID: NPC106770

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Therapeutic Target	Nuclear hormone receptor subfamily 1	RORC	Nuclear receptor ROR-gamma	P51449	CHEMBL1741186

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials
NP level	4

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT00965068	Cholesterol in ASD: Characterization and Treatment	Asperger syndrome;autism	Cholesterol (NPC28657)	NP level
NCT04359823	DSAP Treatment Comparison	porokeratosis	Cholesterol (NPC28657)	NP level
NCT00009841	Gene Therapy in Treating Patients With Advanced Head and Neck Cancer	head and neck malignant neoplasia	Cholesterol (NPC28657)	NP level
NCT00272844	Treatment of the Cholesterol Defect in Smith-Lemli-Opitz Syndrome	Smith-Lemli-Opitz syndrome	Cholesterol (NPC28657)	NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Multiple sclerosis Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A40	F2,RORC
Tetralogy of Fallot Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LA88.2	F2,RORC
Thrombosis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB61-GB90	F2
Thrombocytopenia Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3B64	F2
Bleeding disorder Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA20-GA21	F2
Angina pectoris Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA40	F2
Coronary thrombosis Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA43	F2
Cardiovascular disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA00-BE2Z	F2
Solid tumour/cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00-2F9Z	RORC
Lung cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25	RORC
Myocardial infarction Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA41-BA43	F2
Cerebral ischaemic stroke Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B11	F2
Autoimmune disease Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A40-4A45	RORC
Ischaemic/haemorrhagic stroke Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B20	F2
Asthma Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA23	F2
Coagulation defect Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3B10	F2
Crohn disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD70	RORC
Type 2 diabetes mellitus Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A11	F2
Psoriasis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA90	RORC
Nutritional deficiency Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5B50-5B71	F2
Autism spectrum disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A02	NCT00965068
Autism spectrum disorder without disorder of intellectual development and with mild or no impairment of functional language Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A02.0	NCT00965068
Disorders of cholesterol synthesis Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C52.10	NCT00272844
Porokeratoses Disease Category: 14.Diseases of the skin Disease ICD-11 Code: ED52	NCT04359823
Head and neck cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D42	NCT00009841
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	RORC
Serous cystadenoma,borderline malignancy of ovary Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73.4	RORC
Pheochromocytoma Disease Category: X.Extension Codes Disease ICD-11 Code: XH3854	RORC
Adenocarcinoma of stomach Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72.0	F2
Malignant neoplasm metastasis in lymph nodes of head, face or neck Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D60.0	F2
Squamous cell carcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.2	F2
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	F2
Other specified malignant neoplasms ofcolon Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B90.Y	F2
Other specified malignant neoplasms of kidney, except renal pelvis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90.Y	F2
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	F2
Malignant neoplasms of corpus uteri, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.Z	F2
Germ cell tumour of testis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80.2	F2

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Pittosporum Tobira

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

5 All known Ingredients in Total

5 Ingredients with Acceptable Bioavailablity

3 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Multiple sclerosis

Tetralogy of Fallot

Thrombosis

Thrombocytopenia

Bleeding disorder

Angina pectoris

Coronary thrombosis

Cardiovascular disease

Solid tumour/cancer

Lung cancer

Myocardial infarction

Cerebral ischaemic stroke

Autoimmune disease

Ischaemic/haemorrhagic stroke

Asthma

Coagulation defect

Crohn disease

Type 2 diabetes mellitus

Psoriasis

Nutritional deficiency

Autism spectrum disorder

Autism spectrum disorder without disorder of intellectual development and with mild or no impairment of functional language

Disorders of cholesterol synthesis

Porokeratoses

Head and neck cancer

Carcinosarcoma of uterus

Serous cystadenoma,borderline malignancy of ovary

Pheochromocytoma

Adenocarcinoma of stomach

Malignant neoplasm metastasis in lymph nodes of head, face or neck

Squamous cell carcinoma of bronchus or lung

Adenocarcinoma of pancreas

Other specified malignant neoplasms ofcolon

Other specified malignant neoplasms of kidney, except renal pelvis

Adenocarcinoma of bronchus or lung

Malignant neoplasms of corpus uteri, unspecified

Germ cell tumour of testis

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

>> Targets derived from weak experimental activities