• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Viburnum Dilatatum


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAAACCTGCCCAGCAGAACGACCCGCGAACACGTTTAACTACCGGGGTGCGCCGGTCGGGGCGCGTCAGCCCCCGGCCGGTGCCCCCTCGGTCGGGACGCTCTTCGAGCGGCCAGGCCCAACAACGAACCCCGGCGCGATCCGCGCCAAGGAAATTTAACTGAAGAGCATGCCCCCCGTCGCCCCATTCGCGGCGTGCGCGGGGGTGCCTTGCGCTTTCGAATCACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATTGCGTCGCCCCCACACCCCGCGTCCCCGAAAGGGGAGGCACCGGGCGAGGGGGGCGGATATTGGCCTCCCGTGCTTCCGGGYGCGGTTGGCCCAAAAGCGAGTCCCCGGCAGCGGACGTCACGACAAGTGGTGGTTGAAAAGCCCTCTTATCCTGTCGTGCGGCCCTCCGTTGCCACCGGGCGCTCCCTTGACCCTGACGCGCCGTTCCTGACGGCGCTTCGA

Click for details-----ITS1

TCGAAACCTGCCCAGCAGAACGACCCGCGAACACGTTTAACTACTAGGGCGCACCGGTCGGGGCGCGTCAGCCCCCGGCCGGTGCCCCCTCGGTCGGGACGCTCTTCGAGCGGCCCGGTCCAACAACGAACCCCGGCGCGATCCGCGCCAAGGAAATTTAACTGAAGAGCATGCCCCCGTTGCCCCGTCCGCGGCGTGCGCGGGGTGCCTTGCGCTTTCAAATCACAAA

Click for details-----ITS2

ATTGCGTCGCCCCCACACCCCGTGTCCCCCCGAAAGGGGAGGCACCGGGCGAGGGGGGCGGATATTGGCCTCCCGTGCTTCCGGGCGCGGTTGGCCCAAAAGCGAGTCCCCGGCAGCGGACGTCACGACAAGTGGTGGTTGAAAAGCCCTCTTATCCTGTCGTGCGGCCCTCCGCTGCCACCGGGCGCTCCCTTGACCCTGACGCGCCGTTCCTGACGGCGCTTCGACCGCGACC
Taxonomic Information

Plant ID: NPO1442
Plant Latin Name: Viburnum Dilatatum
Taxonomy Genus: Viburnum
Taxonomy Family: Adoxaceae

Plant External Links:

NCBI TaxonomyDB: 237933
Plant-of-the-World-Online: n.a.

Geographical Distribution
+
−
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

2 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


1 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

1 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC182368

Ingredient ID: NPC17940

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM
Target Type: Individual Protein of Homo sapiens
*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.
.

Detailed Information of Target Proteins

Target TypeProtein ClassGene IDProtein NameUniprot IDTarget ChEMBL ID
No data available in table
Showing 0 to 0 of 0 entries
PreviousNext
Clinical Trials Summary
Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type Number of clinical trials
Clinical trial details
NCT IDTitleConditionForm in clinical useAssociated by plant or compound
No data available in table
Showing 0 to 0 of 0 entries
PreviousNext

❱❱❱ Associated Human Diseases and Detailed Association Evidence

 How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant
Association Type & Detailed Evidence
No data available in table
Showing 0 to 0 of 0 entries
PreviousNext

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network 
Data Section
Select to Download
1. General Info & Plant Usage & Geographical Distribution  
2. Plant Ingredients  
3. Collective Molecular Proteins  
4. Collective Enriched Activities  
5. Plant molecular targets overlapping with DEGs  
6. Associated clinical trials  
7. Associated Human Diseases  
>> Targets derived from weak experimental activities
About Us

The CMAUP database is developed by the Bioinformatics & Drug Design group (BIDD) and School of Pharmacy, Fudan University.

CMAUP

Home

About

Browse

Help

Useful links

BIDD home

NPASS database

TCM-ID database

TTD database

Contact

826 Zhangheng Road, Pudong New District, Shanghai, China

Principle Investigator:
Prof. Chen Yu Zong
chenyuzong@sz.tsinghua.edu.cn
Prof. Zeng Xian
zengxian@fudan.edu.cn

Developer & Maintainer:
Ph.D. Student Dongyue Hou
dyhou22@m.fudan.edu.cn
Mr. Hanbo Lin
hblin19@fudan.edu.cn
Ms. Yuhan Feng
yhfeng22@m.fudan.edu.cn

© 2023 Copyright: Bioinformatics & Drug Design group