CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Corynanthe Johimbe

Example Image

PLANiTS DNA barcode

Click for details-----ITS

TCGAATCCTGCGAAACGCACGACCGTGAACCTGTGTCAACAGCCGGGCGTCGGGTGGCAGGGGAGAATAACCCCTCCCTTCCATACCGGCGCCTTCCGGGTGCCCGTCGCGCGGAAAATGTAACTCAAACCCGGCGCGGAACGCGCCAAGGAAAACTCAATAGGATTGTCAAACCCCCCGATGCCCCGTTCGCGGTGTGCTAGGGGGTGTTGTGGCGCCTGTCGTAATCCAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCTGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCTGCCCCCACAAGTCGTGTGGGGCGGCGGATGTTGGCCTCCCGTGCTGTCAAGCGTGGCCGGCCTAAATGAGAGTCCTCGGCGAGGGACGTCACGATGAGTGGTGGTTGAATGCCCCGACTCGATTTCTGTCGTGCCGGTTCCCCTCGCTGTCTCTGGCTCCACGAATGACCCTCGCGCGCTCTCTCTTTGGAGTCGCGCTCCGACC

Click for details-----ITS1

Click for details-----ITS2

ATCGCGTCGCTGCCCCCACAAGTCGTGTGGGGCGGCGGATGTTGGCCTCCCGTGCTGTCAAGCGTGGCCGGCCTAAATGAGAGTCCTCGGCGAGGGACGTCACGATGAGTGGTGGTTGAATGCCCCGACTCGATTTCTGTCGTGCCGGTTCCCCTCGCTGTCTCTGGCTCCACGAATGACCCTCGCGCGCTCTCTCTTTGGAGTCGCGCTCCGACC

Taxonomic Information

Plant ID: NPO12877
Plant Latin Name: Corynanthe Johimbe
Taxonomy Genus: Corynanthe
Taxonomy Family: Rubiaceae

Plant External Links:

NCBI TaxonomyDB: n.a.
Plant-of-the-World-Online: n.a.

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

1 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

1 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

1 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC313985

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials
Plant level	4

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT00078715	Rapid Antidepressant Effects of Yohimbine in Major Depression	Depression;Involutional\|Major Depresssion	Corynanthe Johimbe	Plant level As plant Extract
NCT01593215	Randomized Study of Yohimbine Treatment for Type 2 Diabetes Patients Carrying a Specific Genetic Risk Variant	Type 2 Diabetes	Corynanthe Johimbe	Plant level As plant Extract
NCT00217048	Effect of Yohimbine on Colon Transit	Healthy Volunteers	Corynanthe Johimbe	Plant level As plant Extract
NCT01031979	Prolonged Exposure for Post Traumatic Stress Disorder (PTSD) With/Without Yohimbine	Post-Traumatic Stress Disorder	Corynanthe Johimbe	Plant level As plant Extract

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Depressive disorders, unspecified Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A7Z	NCT00078715,NCT00078715
Type 2 diabetes mellitus Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A11	NCT01593215
Post-traumatic stress disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6B40	NCT01031979

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases