• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Impatiens Balsamina


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAAAACTATTTCAAACAACCAGTGAACACAATAACAAAACTCGGGATGAGATTGATGACTTCGGTTAGAGTCTCTTCCTATTAATGCGGTTGGGGTGCTCTTTGGGTTCCCCCAACCCATAAACAAACCCCGGCGTAAACCGCCAAGGAATGTTAAAAACAATTGCCACTGTTTTGTCCATTTATATGGCACGAGACATTGGTCTTGGTTATCAACAAACTAAAATGACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAAGCTATTAGGCTGAGGGCACGTCTGCCTGGGCGTCTCGCTTCGTGTCTTCCCATTTCACCTGTGATGGGACGGATAATGGCCTCCTGTGCGACTCTTTGTTGAGCAGTTGGCTGAAATGCAGGTCCATGTTGTAGGACACACGGTTAGTGGTGGTTGAAAATACTGTTTCAAATCGTGTTGTGACTCAACCTGGATCGGTTGACCCCTGTTGTGCCACTGATGGTGCATCGTTTGCGACCCCAGGTCAGG

Click for details-----ITS1

NA

Click for details-----ITS2

TTCGTGTCTTCCCATTTCACCTGTGATGGGACGGATAATGGCCTCCTGTGCGACTCTTTGTTGAGCAGTTGGCTGAAATGCAGGTCCATGTTGTAGGACACACGGTTAGTGGTGGTTGAAAAGACTGTTTCAAATCGTGTTGCGACTCAACCTGGATCGGTTGACCCCTGTTGTGCCCCTGATGGTGCATCGTTTGC
Taxonomic Information

Plant ID: NPO11196
Plant Latin Name: Impatiens Balsamina
Taxonomy Genus: Impatiens
Taxonomy Family: Balsaminaceae

Plant External Links:

NCBI TaxonomyDB: 63779
Plant-of-the-World-Online: 373978-1

Used in Medicines

Country/Region:
Turkey; Indonesia; India; China; Thailand; South Korea

Traditional Medicine System:
Indian Folk; TCM; Unani; Ayurveda; Siddha


Medicinal Functions:

Antibiotic; Cancer; Cathartic; Diuretic; Emetic; Expectorant; Poultice; Tonic; Warts

Geographical Distribution

Turkey; Bangladesh; France; Cameroon; Ecuador; Benin; Cuba; Venezuela; United States; China; Thailand; Dominican Republic; Oman; Tanzania; Indonesia; New Caledonia; Mauritius; Trinidad and Tobago; Haiti; Jamaica; Honduras; Mexico; South Africa; India; Austria; Mozambique; Sri Lanka; Kenya; South Korea; Nicaragua

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

51 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


22 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

25 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99912

Ingredient ID: NPC88450

Ingredient ID: NPC5204

Ingredient ID: NPC483160

Ingredient ID: NPC483159

Ingredient ID: NPC483158

Ingredient ID: NPC483157

Ingredient ID: NPC38059

Ingredient ID: NPC33373

Ingredient ID: NPC324572

Ingredient ID: NPC317973

Ingredient ID: NPC303141

Ingredient ID: NPC302455

Ingredient ID: NPC29666

Ingredient ID: NPC295918

Ingredient ID: NPC285288

Ingredient ID: NPC279081

Ingredient ID: NPC272068

Ingredient ID: NPC270898

Ingredient ID: NPC258957

Ingredient ID: NPC257642

Ingredient ID: NPC257447

Ingredient ID: NPC255626

Ingredient ID: NPC250069

Ingredient ID: NPC244443

Ingredient ID: NPC242307

Ingredient ID: NPC239632

Ingredient ID: NPC228523

Ingredient ID: NPC221404

Ingredient ID: NPC21543

Ingredient ID: NPC20791

Ingredient ID: NPC19721

Ingredient ID: NPC190454

Ingredient ID: NPC185498

Ingredient ID: NPC181465

Ingredient ID: NPC179950

Ingredient ID: NPC176740

Ingredient ID: NPC164802

Ingredient ID: NPC164778

Ingredient ID: NPC15611

Ingredient ID: NPC156021

Ingredient ID: NPC150512

Ingredient ID: NPC138233

Ingredient ID: NPC135092

Ingredient ID: NPC133671

Ingredient ID: NPC129165

Ingredient ID: NPC127624

Ingredient ID: NPC116775

Ingredient ID: NPC112552

Ingredient ID: NPC110899

Ingredient ID: NPC102809