CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Stauntonia Obovatifoliola

Example Image

PLANiTS DNA barcode

Click for details-----ITS

TCGAAACCTGCCCCGACAGGACCCCCGTGAACCATCGACGCAAAAAATCGTTCGGGGAGGGGCGTCGCGTGAGCGACGATCCCCCCTCCCGTCGTGCCGCGAGCCCTGCCCGGATCGTCGGCGCGGACCCCGTCCGCGCCGCGACGCCCCGTCGTCCTCGCGGTCTCGAATTAACAACGCATCCCCGGCGCGACCAGCGTCAAGGAAATTTCACAAGACGCGCGTCTCCGCGGCCCGCCCGCGGACGGCGTCGCGATCCTGATATTTGAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCTAGGCCGTTAGGTCGAGGGCACGTCTGCCTGGGCGTCAAGCATCGCGTCACCCCGACTCCGTCGTCTCACCGCGAGATCCCCCGGAGCCGCGTGGGTGGAGATTGGCCCCCCGTGCGTCGCGCGCGGTCGGCCCAAAAAACGAGCCCCCGACGGCCGGTGTCACGATCAGTGGTGGTTGACGTGCCTCTTTCCGAAGATGGATGTCGTGCCCGCCGCGTCGTCGAACGGGCCATCCGGACCTTGTTGGTGCTCACGGAGCACTCGTCCTCGACCCC

Click for details-----ITS1

Click for details-----ITS2

Taxonomic Information

Plant ID: NPO10155
Plant Latin Name: Stauntonia Obovatifoliola
Taxonomy Genus: Stauntonia
Taxonomy Family: Lardizabalaceae

Plant External Links:

NCBI TaxonomyDB: 161271
Plant-of-the-World-Online: n.a.

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

54 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

48 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

24 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC988

Ingredient ID: NPC93241

Ingredient ID: NPC93016

Ingredient ID: NPC9296

Ingredient ID: NPC88497

Ingredient ID: NPC87517

Ingredient ID: NPC86944

Ingredient ID: NPC84786

Ingredient ID: NPC84592

Ingredient ID: NPC82784

Ingredient ID: NPC77000

Ingredient ID: NPC70867

Ingredient ID: NPC56433

Ingredient ID: NPC55211

Ingredient ID: NPC5413

Ingredient ID: NPC44276

Ingredient ID: NPC309056

Ingredient ID: NPC303838

Ingredient ID: NPC299094

Ingredient ID: NPC295614

Ingredient ID: NPC295317

Ingredient ID: NPC281398

Ingredient ID: NPC270476

Ingredient ID: NPC267948

Ingredient ID: NPC267076

Ingredient ID: NPC260323

Ingredient ID: NPC256063

Ingredient ID: NPC254166

Ingredient ID: NPC252329

Ingredient ID: NPC250323

Ingredient ID: NPC241779

Ingredient ID: NPC239185

Ingredient ID: NPC234248

Ingredient ID: NPC221992

Ingredient ID: NPC21046

Ingredient ID: NPC210216

Ingredient ID: NPC188523

Ingredient ID: NPC182442

Ingredient ID: NPC18074

Ingredient ID: NPC1786

Ingredient ID: NPC177267

Ingredient ID: NPC176130

Ingredient ID: NPC156654

Ingredient ID: NPC155790

Ingredient ID: NPC146416

Ingredient ID: NPC142415

Ingredient ID: NPC123581

Ingredient ID: NPC118210

Ingredient ID: NPC117674

Ingredient ID: NPC116697

Ingredient ID: NPC113917

Ingredient ID: NPC106986

Ingredient ID: NPC103480

Ingredient ID: NPC10051

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Therapeutic Target	Cysteine protease	CASP6	Caspase-6	P55212	CHEMBL3308
Therapeutic Target	Enzyme	CES1	Acyl coenzyme A:cholesterol acyltransferase	P23141	CHEMBL2265
Therapeutic Target	Hydrolase	CES2	Carboxylesterase 2	O00748	CHEMBL3180
Therapeutic Target	Lyase	CA2	Carbonic anhydrase II	P00918	CHEMBL205
Therapeutic Target	Lyase	CA14	Carbonic anhydrase XIV	Q9ULX7	CHEMBL3510
Therapeutic Target	Nuclear hormone receptor subfamily 1	PPARA	Peroxisome proliferator-activated receptor alpha	Q07869	CHEMBL239
Therapeutic Target	Nuclear hormone receptor subfamily 1	PPARD	Peroxisome proliferator-activated receptor delta	Q03181	CHEMBL3979
Therapeutic Target	Nuclear hormone receptor subfamily 1	NR1H4	Bile acid receptor FXR	Q96RI1	CHEMBL2047
Therapeutic Target	Protein Phosphatase	CDC25B	Dual specificity phosphatase Cdc25B	P30305	CHEMBL4804
Therapeutic Target	Surface antigen	F3	Coagulation factor III	P13726	CHEMBL4081
Therapeutic Target	Unclassified protein	ELAVL1	ELAV-like protein 1	Q15717	CHEMBL1250379

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials
NP level	3

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT00029679	Borage Oil and Ginkgo Biloba (EGb 761) in Asthma	asthma	Gamolenic Acid (NPC5413)	NP level
NCT00806442	Treatment of Bronchial Asthma With Borage and Echium Seed Oils	asthma	Gamolenic Acid (NPC5413)	NP level
NCT00072982	Treatment of Rheumatoid Arthritis With Marine and Botanical Oils	rheumatoid arthritis	Gamolenic Acid (NPC5413)	NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Diffuse large B-cell lymphomas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	RBBP7,TERT,PPARA,PTPN1,F3,ACHE,ELAVL1,CASP6,SUZ12
Hepatocellular carcinoma of liver Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.02	AKR1B10,TERT,MAPT,CDC25B,AKR1B10,TERT,MAPT
Solid tumour/cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00-2F9Z	F3,CA2,CA14,TERT,PPARA
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	CA14,TERT,AKR1B10,CASP6,CA2
Serous cystadenoma,borderline malignancy of ovary Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73.4	TERT,AKR1B10,CASP6,CA2,PTPRC
Other specified malignant neoplasms of kidney, except renal pelvis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90.Y	ACHE,TERT,AKR1B10,TERT,PTPRC
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	TERT,AKR1B10,CASP6,CDC25B,PTPRC
Germ cell tumour of testis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80.2	CA14,CDC25B,ACHE,CASP6,PTPRC
Breast cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C60-2C6Y	CA2,CA14,TERT,PTPN1
Pheochromocytoma Disease Category: X.Extension Codes Disease ICD-11 Code: XH3854	CA14,ACHE,CA2,MAPT
Malignant neoplasms of thymus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C27	ACHE,MAPT,AKR1B10,PTPRC
Glaucoma Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9C61	CA2,ACHE,TERT
Hyper-lipoproteinaemia Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C80	PPARD,CES1,PPARA
Alzheimer disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A20	MAPT,ACHE,PPARD
Type 2 diabetes mellitus Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A11	PTPN1,PPARD,PPARA
Acute myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A60	TERT,MAPT,PTPRC
Malignant neoplasms of biliary tract, distal bile duct Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C15	TERT,F3,MAPT
Leishmaniasis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F54	AKR1B10,CDC25B,PTPN1
Malignant neoplasms of oesophagus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B70	CDC25B,ACHE,TERT
Cytomegaloviral disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D82	CA2,CA14,ACHE
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	ACHE,TERT,AKR1B10
Malignant neoplasms of corpus uteri, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.Z	CA2,AKR1B10,TERT
Glioblastoma of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.00	CA2,AKR1B10,PTPRC
Acute diabete complication Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A2Y	PPARA,PTPN1
Non-alcoholic fatty liver disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB92	PPARD,PPARA
Obesity Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5B80-5B81	PPARD,PTPN1
Pancreatic cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10	F3,TERT
Lung cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25	TERT,CDC25B
Bacterial infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1A00-1C4Z	CA14,CA2
Parkinsonism Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A00	ACHE,MAPT
Rheumatoid arthritis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA20	CA2 NCT00072982
Dyslipidemia Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C80-5C81	PPARD,PPARA
Metabolic disorder Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C50-5D2Z	PTPN1,PPARD
Mild neurocognitive disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6D71	MAPT,ACHE
Asthma Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA23	NCT00029679,NCT00806442
Adenocarcinoma of stomach Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72.0	TERT,CDC25B
Squamous cell carcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.2	AKR1B10,TERT
Tetralogy of Fallot Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LA88.2	CA14,F3
Melanoma of skin Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C30	TERT,PTPRC
Superficial ovarian endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10.B4	CA2,ACHE
Urothelial carcinoma of bladder Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C94.2	CA2,TERT
Systemic lupus erythematosus Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A40.0	ACHE,F3
Renal cell carcinoma, chromophobe type Disease Category: X.Extension Codes Disease ICD-11 Code: XH6153	TERT,CA2
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	CA14,CES2,TERT,PTPN1,PPARD,ACHE,AKR1B10,CES1,CA2,CDC25B,PTPRC
Substance abuse Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6C40	ACHE
Chronic arterial occlusive disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD4Z	CES1
Pain, unspecified Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG3Z	ACHE
Peroxisomal disease Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C57	CES1
Nasopharyngeal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B6B	CDC25B
Transplant rejection Disease Category: 22.Injury, poisoning or certain other consequences of external causes Disease ICD-11 Code: NE84	PTPRC
Inborn lipid metabolism error Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C52	PPARA
Thrombocytosis Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3B63	TERT
Mature T-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A90	PTPRC
Ovarian cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73	TERT
Low bone mass disorder Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FB83	CA2
Hyperlipidemia Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C80	PPARA
Parasitic worm infestation Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F90	ACHE
Brain cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00	TERT
Diffuse large B-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	PTPRC
Gout Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA25	PPARA
Malignant haematopoietic neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B33	PTPRC
Melanoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C30	TERT
Transplanted organ/tissue Disease Category: 24.Factors influencing health status or contact with health services Disease ICD-11 Code: QB63	PTPRC
Duodenal ulcer Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA63	CA2
Myasthenia gravis Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C6Y	ACHE
BCR-ABL1-negative chronic myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A41	PTPRC
Autoimmune liver disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB96	PPARD
Insomnia Disease Category: 07.Sleep-wake disorders Disease ICD-11 Code: 7A00-7A0Z	CA2
Heart failure Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD10-BD1Z	CA2
Prostate cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C82	TERT
Head and neck cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D42	TERT
Postoperative inflammation Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1A00-CA43	PTPN1
Myelodysplastic syndrome Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A37	TERT
Acute respiratory distress syndrome Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CB00	F3
Oesophageal/gastroduodenal disorder Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD90	ACHE
Inborn metabolism deficiency Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C50-5C59	CA14
Multiple myeloma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A83	TERT
Seborrhoeic dermatitis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA81	CA2
Myeloproliferative neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A20	TERT
Synthesis disorder Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C52-5C59	CES1
Essential hypertension Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA00	CA2
Liver cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12	TERT
Cardiovascular disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA00-BE2Z	PPARA
Ophthalmic devices/implants/grafts injury Disease Category: 23.External causes of morbidity or mortality Disease ICD-11 Code: PK97	PTPN1
Pediculosis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1G00	ACHE
Bleeding disorder Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA20-GA21	F3
Colorectal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B91	TERT
Diabetes mellitus, type unspecified Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A14	PPARA
Dementia Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6D80-6D8Z	ACHE
Choreiform disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A01	MAPT
Unspecific substance harmful effect Disease Category: 22.Injury, poisoning or certain other consequences of external causes Disease ICD-11 Code: NE6Z	ACHE
Zika virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D48	ACHE
Psoriasis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA90	AKR1B10
Hepatoblastoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.01	AKR1B10
Malignant neoplasm metastasis in lymph nodes of head, face or neck Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D60.0	TERT
West Nile virus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D46	ACHE
Other specified malignant neoplasms ofcolon Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B90.Y	CDC25B
Other specified malignant neoplasms of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.Y	AKR1B10
Adenocarcinoma of prostate Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C82.0	TERT
Chikungunya virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D40	F3
Invasive carcinoma of breast Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C61	TERT
Ebola virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D60.01	ACHE
Malignant neoplasms of adrenal gland Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D11	TERT
Gliomas of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.0	AKR1B10

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Stauntonia Obovatifoliola

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

54 All known Ingredients in Total

48 Ingredients with Acceptable Bioavailablity

24 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Diffuse large B-cell lymphomas

Hepatocellular carcinoma of liver

Solid tumour/cancer

Carcinosarcoma of uterus

Serous cystadenoma,borderline malignancy of ovary

Other specified malignant neoplasms of kidney, except renal pelvis

Mesothelioma of pleura

Germ cell tumour of testis

Breast cancer

Pheochromocytoma

Malignant neoplasms of thymus

Glaucoma

Hyper-lipoproteinaemia

Alzheimer disease

Type 2 diabetes mellitus

Acute myeloid leukaemia

Malignant neoplasms of biliary tract, distal bile duct

Leishmaniasis

Malignant neoplasms of oesophagus

Cytomegaloviral disease

Adenocarcinoma of bronchus or lung

Malignant neoplasms of corpus uteri, unspecified

Glioblastoma of brain

Acute diabete complication

Non-alcoholic fatty liver disease

Obesity

Pancreatic cancer

Lung cancer

Bacterial infection

Parkinsonism

Rheumatoid arthritis

Dyslipidemia

Metabolic disorder

Mild neurocognitive disorder

Asthma

Adenocarcinoma of stomach

Squamous cell carcinoma of bronchus or lung

Tetralogy of Fallot

Melanoma of skin

Superficial ovarian endometriosis

Urothelial carcinoma of bladder

Systemic lupus erythematosus

Renal cell carcinoma, chromophobe type

Adenocarcinoma of pancreas

Substance abuse

Chronic arterial occlusive disease

Pain, unspecified

Peroxisomal disease

Nasopharyngeal cancer

Transplant rejection

Inborn lipid metabolism error

Thrombocytosis

Mature T-cell lymphoma

Ovarian cancer

Low bone mass disorder

Hyperlipidemia

Parasitic worm infestation

Brain cancer

Diffuse large B-cell lymphoma

Gout

Malignant haematopoietic neoplasm

Melanoma

Transplanted organ/tissue

Duodenal ulcer