• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Eurycoma Longifolia


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCAGCAGAACGACCCGCGAACAAGTGATGAAAACCGGAGTGGGGGGCGAACGGGTGTCGCTCGCTCGCGTCTCCCTCCTCGCTGCCTGGTGGGAGGGCCCCGTCCGCGGGACCTTACCCCGGGGAGCAAAAACGAACCCCGGCGCGGACTGCGCCAAGGAAAACAAACGAGAGAGTGTGCCCTCGCTGCCCCGGATACGGTGAGCACGGGGGTGCTGCCTTCTTTCAAATAAAGTCTATAACGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGTTAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTCGCCCCCCCTCCCCCTCGCCTCCCACCCGAGGCGCGCCGGAGCCGTGGGGCGGATACTGGCCTCCCGTGCGCTCCCCGCTCGCGGTTGGCCCAAATTCGAGTCCTCGGCGGCGGTCGCCGCGACGATCGGTGGCGAAAATTTCTTTCATCGAGTTCCCGTCGTGCGCGCCCGCCCCTGGAACGGGGGCTCCTCGGACCCTGATGCGCCATTTTCTTCGGCGTTCGCTTTGCGACCCCAGGTCAGGCGGG

Click for details-----ITS1

TGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCAGCAGAACGACCCGCGAACAAGTGATGAAAACCGGAGTGGGGGGCGAACGGGTGTCGCTCGCTCGCGTCTCCCTCCTCGCTGCCTGGTGGGAGGGCCCCGTCCGCGGGACCTTACCCCGGGGAGCAAAAACGAACCCCGGCGCGGACTGCGCCAAGGAAAACAAACGAGAGAGTGTGCCCTCGCTGCCCCGGATACGGTGAGCACGGGGGTGCTGCCTTCTTTCAAATAAAGTCTATAA

Click for details-----ITS2

ATCGTCGCCCCCCCTCCCCCTCGCCTCCCACCCGAGGCGCGCCGGAGCCGTGGGGCGGATACTGGCCTCCCGTGCGCTCCCCGCTCGCGGTTGGCCCAAATTCGAGTCCTCGGCGGCGGTCGCCGCGACGATCGGTGGCGAAAATTTCTTTCATCGAGTTCCCGTCGTGCGCGCCCGCCCCTGGAACGGGGGCTCCTCGGACCCTGATGCGCCATTTTCTTCGGCGTTCGCTTTGCGACCCCAGGTCAGGCGGG
Taxonomic Information

Plant ID: NPO9965
Plant Latin Name: Eurycoma Longifolia
Taxonomy Genus: Eurycoma
Taxonomy Family: Simaroubaceae

Plant External Links:

NCBI TaxonomyDB: 458531
Plant-of-the-World-Online: 813715-1

Used in Medicines

Country/Region:
Malaysia; Indonesia; China; India; Thailand

Traditional Medicine System:
Indian Folk; TCM

Geographical Distribution

Myanmar; Indonesia; India; Cambodia; Malaysia; Vietnam; China; Laos; Thailand

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

198 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


160 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

91 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99891

Ingredient ID: NPC9879

Ingredient ID: NPC97042

Ingredient ID: NPC96294

Ingredient ID: NPC94024

Ingredient ID: NPC93712

Ingredient ID: NPC91160

Ingredient ID: NPC89876

Ingredient ID: NPC85803

Ingredient ID: NPC85273

Ingredient ID: NPC84713

Ingredient ID: NPC84064

Ingredient ID: NPC82911

Ingredient ID: NPC82548

Ingredient ID: NPC81090

Ingredient ID: NPC7921

Ingredient ID: NPC76336

Ingredient ID: NPC75844

Ingredient ID: NPC75383

Ingredient ID: NPC73212

Ingredient ID: NPC71339

Ingredient ID: NPC70604

Ingredient ID: NPC68272

Ingredient ID: NPC65465

Ingredient ID: NPC64470

Ingredient ID: NPC63546

Ingredient ID: NPC62749

Ingredient ID: NPC61198

Ingredient ID: NPC60621

Ingredient ID: NPC59224

Ingredient ID: NPC58587

Ingredient ID: NPC5832

Ingredient ID: NPC56233

Ingredient ID: NPC55363

Ingredient ID: NPC55086

Ingredient ID: NPC53144

Ingredient ID: NPC50763

Ingredient ID: NPC50529

Ingredient ID: NPC50362

Ingredient ID: NPC482441

Ingredient ID: NPC482440

Ingredient ID: NPC482439

Ingredient ID: NPC482438

Ingredient ID: NPC482437

Ingredient ID: NPC482436

Ingredient ID: NPC482435

Ingredient ID: NPC482434

Ingredient ID: NPC48069

Ingredient ID: NPC48043

Ingredient ID: NPC478686

Ingredient ID: NPC477046

Ingredient ID: NPC47229

Ingredient ID: NPC472004

Ingredient ID: NPC472003

Ingredient ID: NPC472002

Ingredient ID: NPC472001

Ingredient ID: NPC472000

Ingredient ID: NPC471999

Ingredient ID: NPC469488

Ingredient ID: NPC44206

Ingredient ID: NPC43350

Ingredient ID: NPC41476

Ingredient ID: NPC40402

Ingredient ID: NPC39624

Ingredient ID: NPC3852

Ingredient ID: NPC37739

Ingredient ID: NPC35741

Ingredient ID: NPC3316

Ingredient ID: NPC32534

Ingredient ID: NPC31505

Ingredient ID: NPC312934

Ingredient ID: NPC306085

Ingredient ID: NPC305956

Ingredient ID: NPC305347

Ingredient ID: NPC305043

Ingredient ID: NPC302622

Ingredient ID: NPC300424

Ingredient ID: NPC29884

Ingredient ID: NPC298680

Ingredient ID: NPC297539

Ingredient ID: NPC296986

Ingredient ID: NPC295898

Ingredient ID: NPC293487

Ingredient ID: NPC292133

Ingredient ID: NPC284678

Ingredient ID: NPC284637

Ingredient ID: NPC281310

Ingredient ID: NPC281094

Ingredient ID: NPC279299

Ingredient ID: NPC277017

Ingredient ID: NPC275583

Ingredient ID: NPC275537

Ingredient ID: NPC274982

Ingredient ID: NPC274613

Ingredient ID: NPC273244

Ingredient ID: NPC269150

Ingredient ID: NPC267318

Ingredient ID: NPC267160

Ingredient ID: NPC266249

Ingredient ID: NPC262870

Ingredient ID: NPC261012

Ingredient ID: NPC259525

Ingredient ID: NPC259256

Ingredient ID: NPC258284

Ingredient ID: NPC256714

Ingredient ID: NPC256326

Ingredient ID: NPC256227

Ingredient ID: NPC254140

Ingredient ID: NPC251310

Ingredient ID: NPC249216

Ingredient ID: NPC24864

Ingredient ID: NPC248430

Ingredient ID: NPC246464

Ingredient ID: NPC243728

Ingredient ID: NPC241522

Ingredient ID: NPC241499

Ingredient ID: NPC237276

Ingredient ID: NPC233202

Ingredient ID: NPC230541

Ingredient ID: NPC229025

Ingredient ID: NPC226861

Ingredient ID: NPC226508

Ingredient ID: NPC226355

Ingredient ID: NPC22557

Ingredient ID: NPC219913

Ingredient ID: NPC219702

Ingredient ID: NPC2135

Ingredient ID: NPC213086

Ingredient ID: NPC212213

Ingredient ID: NPC210786

Ingredient ID: NPC210005

Ingredient ID: NPC208998

Ingredient ID: NPC208304

Ingredient ID: NPC205524

Ingredient ID: NPC204552

Ingredient ID: NPC203719

Ingredient ID: NPC201547

Ingredient ID: NPC200934

Ingredient ID: NPC200836

Ingredient ID: NPC199945

Ingredient ID: NPC197009

Ingredient ID: NPC194493

Ingredient ID: NPC19412

Ingredient ID: NPC192813

Ingredient ID: NPC190979

Ingredient ID: NPC189791

Ingredient ID: NPC189642

Ingredient ID: NPC188738

Ingredient ID: NPC188667

Ingredient ID: NPC188066

Ingredient ID: NPC181838

Ingredient ID: NPC181357

Ingredient ID: NPC177548

Ingredient ID: NPC175294

Ingredient ID: NPC174764

Ingredient ID: NPC174758

Ingredient ID: NPC171888

Ingredient ID: NPC168911

Ingredient ID: NPC167400

Ingredient ID: NPC167384

Ingredient ID: NPC165330

Ingredient ID: NPC162213

Ingredient ID: NPC160577

Ingredient ID: NPC156654

Ingredient ID: NPC156461

Ingredient ID: NPC155752

Ingredient ID: NPC154608

Ingredient ID: NPC153239

Ingredient ID: NPC151013

Ingredient ID: NPC148835

Ingredient ID: NPC146945

Ingredient ID: NPC146728

Ingredient ID: NPC144854

Ingredient ID: NPC142722

Ingredient ID: NPC141350

Ingredient ID: NPC141224

Ingredient ID: NPC139519

Ingredient ID: NPC138598

Ingredient ID: NPC137345

Ingredient ID: NPC136810

Ingredient ID: NPC135097

Ingredient ID: NPC13362

Ingredient ID: NPC132554

Ingredient ID: NPC128118

Ingredient ID: NPC12649

Ingredient ID: NPC123132

Ingredient ID: NPC122922

Ingredient ID: NPC122317

Ingredient ID: NPC122022

Ingredient ID: NPC120312

Ingredient ID: NPC116018

Ingredient ID: NPC112038

Ingredient ID: NPC111888

Ingredient ID: NPC110899

Ingredient ID: NPC109562

Ingredient ID: NPC106307

Ingredient ID: NPC102822

Ingredient ID: NPC102352