• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Isoplexis Sceptrum


Example Image
PLANiTS DNA barcode

Click for details-----ITS

CCTGCGGAAGGATCATTGTCGAAACCTGCAAAGCAGACCCGTGAACATGTTTTTAACTTGAATGGTGATGCAATAGGATGCGCAAGCCTCCTGTTATATCATTGTGCTTGCTTGACACTTGTGTCTTGTGGGCTAACGAACCCCGGCGCGGCATGCGCCAAGGAAAACTTAAAGAAGCGTTGCCCCTGTGACCCTCGTTTGCGGTGCGGTCTTAGGGATGCAATGTCTTTCGAATGTCTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCTCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGTTGAGGGCACGTCTGCCTGGGCGTCTCACATCGCGTCGCCCCCTCTAAATCCAATTTGGAAGGGGCGGAAATTGGTCTCCCGTGCATCATTGTGTGTGCGGCTGGCCCAAATAAGATCCCTAATTGATGGTTGTCATGACTGGTGGTAGTTGAAAACTCAATCCTGCTGTTGTGACTTACACTATTCTTTATAGGGCATCGAATTGACCCAATGGTACAAATAGTACCTTCGA

Click for details-----ITS1

CCTGCGGAAGGATCATTGTCGAAACCTGCAAAGCAGACCCGTGAACATGTTTTTAACTTGAATGGTGATGCAATAGGATGCGCAAGCCTCCTGTTATATCATTGTGCTTGCTTGACACTTGTGTCTTGTGGGCTAACGAACCCCGGCGCGGCATGCGCCAAGGAAAACTTAAAGAAGCGTTGCCCCTGTGACCCTCGTTTGCGGTGCGGTCTTAGGGATGCAATGTCTTTCGAATGTCTAAA

Click for details-----ITS2

ATCGCGTCGCCCCCTCTAAATCCAATTTGGAAGGGGCGGAAATTGGTCTCCCGTGCATCATTGTGTGTGCGGCTGGCCCAAATAAGATCCCTAATTGATGGTTGTCATGACTGGTGGTAGTTGAAAACTCAATCCTGCTGTTGTGACTTACACTATTCTTTATAGGGCATCGAATTGACCCAATGGTACAAATAGTACCTTCGA
Taxonomic Information

Plant ID: NPO9952
Plant Latin Name: Isoplexis Sceptrum
Taxonomy Genus: Isoplexis
Taxonomy Family: Plantaginaceae

Plant External Links:

NCBI TaxonomyDB: 285845
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

124 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


89 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

18 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99964

Ingredient ID: NPC99006

Ingredient ID: NPC98175

Ingredient ID: NPC96337

Ingredient ID: NPC93194

Ingredient ID: NPC91972

Ingredient ID: NPC88603

Ingredient ID: NPC85637

Ingredient ID: NPC82287

Ingredient ID: NPC80692

Ingredient ID: NPC77579

Ingredient ID: NPC75247

Ingredient ID: NPC74758

Ingredient ID: NPC72237

Ingredient ID: NPC68173

Ingredient ID: NPC67532

Ingredient ID: NPC61305

Ingredient ID: NPC61057

Ingredient ID: NPC58959

Ingredient ID: NPC58809

Ingredient ID: NPC55154

Ingredient ID: NPC54199

Ingredient ID: NPC53449

Ingredient ID: NPC52620

Ingredient ID: NPC51920

Ingredient ID: NPC51694

Ingredient ID: NPC49327

Ingredient ID: NPC42150

Ingredient ID: NPC311969

Ingredient ID: NPC307021

Ingredient ID: NPC306551

Ingredient ID: NPC306009

Ingredient ID: NPC305642

Ingredient ID: NPC304373

Ingredient ID: NPC3031

Ingredient ID: NPC301983

Ingredient ID: NPC298934

Ingredient ID: NPC298509

Ingredient ID: NPC297084

Ingredient ID: NPC295534

Ingredient ID: NPC293804

Ingredient ID: NPC292090

Ingredient ID: NPC291186

Ingredient ID: NPC289642

Ingredient ID: NPC286188

Ingredient ID: NPC28583

Ingredient ID: NPC282999

Ingredient ID: NPC280452

Ingredient ID: NPC27744

Ingredient ID: NPC275846

Ingredient ID: NPC273757

Ingredient ID: NPC272256

Ingredient ID: NPC267068

Ingredient ID: NPC260507

Ingredient ID: NPC255467

Ingredient ID: NPC255076

Ingredient ID: NPC255042

Ingredient ID: NPC255027

Ingredient ID: NPC253679

Ingredient ID: NPC253301

Ingredient ID: NPC25317

Ingredient ID: NPC251097

Ingredient ID: NPC251031

Ingredient ID: NPC250563

Ingredient ID: NPC247380

Ingredient ID: NPC246096

Ingredient ID: NPC245419

Ingredient ID: NPC239242

Ingredient ID: NPC234424

Ingredient ID: NPC231276

Ingredient ID: NPC230960

Ingredient ID: NPC225136

Ingredient ID: NPC220140

Ingredient ID: NPC218298

Ingredient ID: NPC21078

Ingredient ID: NPC209575

Ingredient ID: NPC208485

Ingredient ID: NPC202369

Ingredient ID: NPC199623

Ingredient ID: NPC198272

Ingredient ID: NPC197059

Ingredient ID: NPC196733

Ingredient ID: NPC196333

Ingredient ID: NPC195624

Ingredient ID: NPC195287

Ingredient ID: NPC194465

Ingredient ID: NPC194456

Ingredient ID: NPC189840

Ingredient ID: NPC187217

Ingredient ID: NPC184203

Ingredient ID: NPC18215

Ingredient ID: NPC18205

Ingredient ID: NPC179650

Ingredient ID: NPC179576

Ingredient ID: NPC178152

Ingredient ID: NPC174525

Ingredient ID: NPC174406

Ingredient ID: NPC173721

Ingredient ID: NPC173305

Ingredient ID: NPC172112

Ingredient ID: NPC172093

Ingredient ID: NPC164646

Ingredient ID: NPC164498

Ingredient ID: NPC161088

Ingredient ID: NPC160468

Ingredient ID: NPC157538

Ingredient ID: NPC156461

Ingredient ID: NPC156018

Ingredient ID: NPC145154

Ingredient ID: NPC144916

Ingredient ID: NPC142438

Ingredient ID: NPC140857

Ingredient ID: NPC137739

Ingredient ID: NPC137136

Ingredient ID: NPC126998

Ingredient ID: NPC121958

Ingredient ID: NPC119250

Ingredient ID: NPC116517

Ingredient ID: NPC115448

Ingredient ID: NPC10781

Ingredient ID: NPC103560

Ingredient ID: NPC10151

Ingredient ID: NPC101079

Ingredient ID: NPC100135