• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Polygonatum Sibiricum


Example Image
PLANiTS DNA barcode

Click for details-----ITS

GGGGCGGAGGGAGGGCGGACGTTCCAGCCGCCCGAACCCCGCCACCCCGGGGCCCCGATGCCGCCCCCGCCCCGCCTCGCTGCGGGACGGGCGGCGGGAACAATACCCGGCGCGGTGGGCGCCAAGGAACACTGATGTCGGAGAGCGCCGCACGCCGGTCCCGGCGCGCGGCGCGATCCTTCCATACGTCGAACTTTTACGACTCTCGGCAACGGATATCTTGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCTATCCGGCCGAGGGCACGCCTGCCTGGGCATCACGCCTCGCGTCGCTCCGCGCACCCCGCCCCCCGGCCCCGGGGAGTCGGCGGGCGCGGACGCGGAGATTGGCCCCCCGTGCCTCGCGGCGCGGCGGGCCGAAGTGCGGGCCGCCGGCCGGGACGGACGCGGCGAGTGGTGGACGGACACGTACGGCGCTTAACGCCGCCTCCGGCCCCCGGCCCCAGCGGCGCATGCAAAGGAACCCACGCCGAGCA

Click for details-----ITS1

GGGGCGGAGGGAGGGCGGACGTTCCAGCCGCCCGAACCCCGCCACCCCGGGGCCCCGATGCCGCCCCCGCCCCGCCTCGCTGCGGGACGGGCGGCGGGAACAATACCCGGCGCGGTGGGCGCCAAGGAACACTGATGTCGGAGAGCGCCGCACGCCGGTCCCGGCGCGCGGCGCGATCCTTCCATACGTCGAACTTTTA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO9935
Plant Latin Name: Polygonatum Sibiricum
Taxonomy Genus: Polygonatum
Taxonomy Family: Asparagaceae

Plant External Links:

NCBI TaxonomyDB: 261423
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
China

Traditional Medicine System:
TCM


Medicinal Functions:

Antibacterial; Antifungal; Antirheumatic; Demulcent; Lenitive; Miscellany; Tonic

Geographical Distribution

China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

18 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


11 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

12 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC66343

Ingredient ID: NPC63609

Ingredient ID: NPC57429

Ingredient ID: NPC477811

Ingredient ID: NPC477810

Ingredient ID: NPC477809

Ingredient ID: NPC477808

Ingredient ID: NPC477807

Ingredient ID: NPC312977

Ingredient ID: NPC30127

Ingredient ID: NPC22895

Ingredient ID: NPC19174

Ingredient ID: NPC156358

Ingredient ID: NPC155156

Ingredient ID: NPC147686

Ingredient ID: NPC133961

Ingredient ID: NPC107482

Ingredient ID: NPC100551