• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Rhododendron Latoucheae


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

GCGAAACCTGCCAACAAGCAGAAAACTTGCGAACTTGTCTAATACAGTGGGGAATGCGTGGGTTGGGGCCTTGTTCTCTTTCCTTCCGCTTTCCCCTCGCGAGTAGATGTGCGCGGAGCTTTTGGGCAACGTGTTCATTTACTTGTTAAACAAACGAACCCCGGCGCAAAACGCGCCAAGGATAATTGAACAAAGTTTGTGCACGTCCCCTGCCTGCTTTCGGGTGGTGTTGGCTTGCACATCTTTCGAATAACTAAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO9925
Plant Latin Name: Rhododendron Latoucheae
Taxonomy Genus: Rhododendron
Taxonomy Family: Ericaceae

Plant External Links:

NCBI TaxonomyDB: 184576
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

43 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


36 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

25 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99707

Ingredient ID: NPC95468

Ingredient ID: NPC94245

Ingredient ID: NPC93850

Ingredient ID: NPC90185

Ingredient ID: NPC74914

Ingredient ID: NPC64332

Ingredient ID: NPC51681

Ingredient ID: NPC479529

Ingredient ID: NPC479528

Ingredient ID: NPC479527

Ingredient ID: NPC479526

Ingredient ID: NPC479525

Ingredient ID: NPC479524

Ingredient ID: NPC479523

Ingredient ID: NPC479522

Ingredient ID: NPC469895

Ingredient ID: NPC35410

Ingredient ID: NPC32411

Ingredient ID: NPC295998

Ingredient ID: NPC280399

Ingredient ID: NPC26960

Ingredient ID: NPC267077

Ingredient ID: NPC26544

Ingredient ID: NPC257790

Ingredient ID: NPC253714

Ingredient ID: NPC24238

Ingredient ID: NPC233529

Ingredient ID: NPC233224

Ingredient ID: NPC226762

Ingredient ID: NPC204120

Ingredient ID: NPC203468

Ingredient ID: NPC198330

Ingredient ID: NPC195986

Ingredient ID: NPC183987

Ingredient ID: NPC174191

Ingredient ID: NPC164023

Ingredient ID: NPC162994

Ingredient ID: NPC157944

Ingredient ID: NPC15743

Ingredient ID: NPC139209

Ingredient ID: NPC126935

Ingredient ID: NPC116711