• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Cichorium Intybus


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAACCCTGCAAGCAGAACGACCCGTGAACATGTACCTATAACCGGGAGTCAGGTGTATKGGCCTTGGCCCTATCGCTGGCACCCCGTCGGCTTATGTTTGTGGTTGCCCCATTTGGGGTGCCATGGATTTTAATCCGGCACCATAACAAACCCCGGGCACGGTATGTGCCAAGGAAAACAATAAATGAGAAGGATACGTCCAACTTTGTCCCGTTCGCGGTGTGCATGTTGGTCGTGGCCTCCTTAGAATCACAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATCCGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCAACCATGCATCCCTTATCGGGACACATGGCATCGGGGCGGAGATTGGTCTCCCGTGCTTATGGTGCGGTTGGCCTAAACTGGAGTCCCCTTCGGTGGACGCACGACTAGTGGTGGTTGAAAAGACCCTCGTATTGTGTCGTGCGTCATTTGCTGTGAGGGAGGCCCTTGATGAAGACCCCAATGTATCGTCTTGAGACGATGCTTCGAC

Click for details-----ITS1

TCGAACCCTGCAAGCAGAACGACCCGTGAACATGTACCTATAACCGGGAGTCAGGTGTATKGGCCTTGGCCCTATCGCTGGCACCCCGTCGGCTTATGTTTGTGGTTGCCCCATTTGGGGTGCCATGGATTTTAATCCGGCACCATAACAAACCCCGGGCACGGTATGTGCCAAGGAAAACAATAAATGAGAAGGATACGTCCAACTTTGTCCCGTTCGCGGTGTGCATGTTGGTCGTGGCCTCCTTAGAATCACAAA

Click for details-----ITS2

ATCGCGTCGCCCCCAACCATGCATCCCTTATCGGGACACATGGCATCGGGGCGGAGATTGGTCTCCCGTGCTTATGGTGCGGTTGGCCTAAACTGGAGTCCCCTTCGGTGGACGCACGACTAGTGGTGGTTGAAAAGACCCTCGTATTGTGTCGTGCGTCRTGYGCTGTGAGGGAGGCCCTTGATGAAGACCCCAATGTRTCGTCTTGAGACGATGCACTCGAC
Taxonomic Information

Plant ID: NPO9865
Plant Latin Name: Cichorium Intybus
Taxonomy Genus: Cichorium
Taxonomy Family: Asteraceae

Plant External Links:

NCBI TaxonomyDB: 13427
Plant-of-the-World-Online: 194533-1

Used in Medicines

Country/Region:
Turkey; Madagascar; Albania; Italy; South Africa; India; Lithuania; Zimbabwe; Jordan; Swaziland; Angola; China

Traditional Medicine System:
Indian Folk; Unani; Siddha; Ayurveda; TCM; Homeopathy


Medicinal Functions:

Appetizer; Bach; Cardiac; Cholagogue; Depurative; Digestive; Diuretic; Hypoglycaemic; Laxative; Tonic; Warts

Geographical Distribution

Brazil; Afghanistan; Madagascar; Italy; Bangladesh; Canada; Kuwait; Lithuania; Cambodia; France; Ethiopia; Netherlands; Suriname; Laos; Uruguay; Argentina; Venezuela; Thailand; Turkmenistan; Uzbekistan; Saudi Arabia; Australia; Iran; Algeria; Turkey; Jordan; United States; Guatemala; Zimbabwe; China; Chile; Germany; Iraq; Kazakhstan; Poland; Spain; Ukraine; Georgia; Libya; Oman; Philippines; Indonesia; Swaziland; Morocco; Sweden; Belarus; French Guiana; Mongolia; Guyana; Switzerland; Honduras; New Zealand; Yemen; Russia; Bulgaria; Pakistan; Romania; Albania; Angola; Portugal; Myanmar; Mexico; Egypt; South Africa; India; United Kingdom; Lesotho; Austria; Vietnam; Tunisia; Greece; Paraguay; Hungary; Taiwan; Tajikistan

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

266 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


157 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

130 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99060

Ingredient ID: NPC96128

Ingredient ID: NPC95247

Ingredient ID: NPC94167

Ingredient ID: NPC93888

Ingredient ID: NPC93730

Ingredient ID: NPC92774

Ingredient ID: NPC88686

Ingredient ID: NPC86655

Ingredient ID: NPC86412

Ingredient ID: NPC85813

Ingredient ID: NPC85488

Ingredient ID: NPC85482

Ingredient ID: NPC85473

Ingredient ID: NPC82711

Ingredient ID: NPC81852

Ingredient ID: NPC81388

Ingredient ID: NPC81010

Ingredient ID: NPC79483

Ingredient ID: NPC78379

Ingredient ID: NPC78272

Ingredient ID: NPC76176

Ingredient ID: NPC74595

Ingredient ID: NPC74434

Ingredient ID: NPC72722

Ingredient ID: NPC71843

Ingredient ID: NPC69445

Ingredient ID: NPC68798

Ingredient ID: NPC68779

Ingredient ID: NPC68517

Ingredient ID: NPC66005

Ingredient ID: NPC62230

Ingredient ID: NPC62045

Ingredient ID: NPC61867

Ingredient ID: NPC61159

Ingredient ID: NPC60151

Ingredient ID: NPC58636

Ingredient ID: NPC57233

Ingredient ID: NPC55412

Ingredient ID: NPC5447

Ingredient ID: NPC50898

Ingredient ID: NPC491218

Ingredient ID: NPC490424

Ingredient ID: NPC490348

Ingredient ID: NPC489907

Ingredient ID: NPC48764

Ingredient ID: NPC481228

Ingredient ID: NPC481227

Ingredient ID: NPC47993

Ingredient ID: NPC47844

Ingredient ID: NPC47287

Ingredient ID: NPC46274

Ingredient ID: NPC424

Ingredient ID: NPC39360

Ingredient ID: NPC38408

Ingredient ID: NPC37331

Ingredient ID: NPC36408

Ingredient ID: NPC35342

Ingredient ID: NPC34241

Ingredient ID: NPC3357

Ingredient ID: NPC329344

Ingredient ID: NPC329274

Ingredient ID: NPC328447

Ingredient ID: NPC328047

Ingredient ID: NPC327572

Ingredient ID: NPC327548

Ingredient ID: NPC32626

Ingredient ID: NPC324852

Ingredient ID: NPC324729

Ingredient ID: NPC321179

Ingredient ID: NPC3206

Ingredient ID: NPC320538

Ingredient ID: NPC317120

Ingredient ID: NPC316831

Ingredient ID: NPC316669

Ingredient ID: NPC313955

Ingredient ID: NPC311700

Ingredient ID: NPC31152

Ingredient ID: NPC308689

Ingredient ID: NPC307063

Ingredient ID: NPC306462

Ingredient ID: NPC303211

Ingredient ID: NPC302857

Ingredient ID: NPC302223

Ingredient ID: NPC302172

Ingredient ID: NPC301950

Ingredient ID: NPC300282

Ingredient ID: NPC29883

Ingredient ID: NPC297517

Ingredient ID: NPC295320

Ingredient ID: NPC294902

Ingredient ID: NPC294548

Ingredient ID: NPC292198

Ingredient ID: NPC291650

Ingredient ID: NPC290613

Ingredient ID: NPC290319

Ingredient ID: NPC29

Ingredient ID: NPC288826

Ingredient ID: NPC287174

Ingredient ID: NPC284948

Ingredient ID: NPC283255

Ingredient ID: NPC281686

Ingredient ID: NPC279121

Ingredient ID: NPC278068

Ingredient ID: NPC277867

Ingredient ID: NPC27765

Ingredient ID: NPC277208

Ingredient ID: NPC277205

Ingredient ID: NPC275255

Ingredient ID: NPC274533

Ingredient ID: NPC273603

Ingredient ID: NPC272614

Ingredient ID: NPC269919

Ingredient ID: NPC268298

Ingredient ID: NPC267649

Ingredient ID: NPC264317

Ingredient ID: NPC262285

Ingredient ID: NPC261831

Ingredient ID: NPC261418

Ingredient ID: NPC259690

Ingredient ID: NPC257582

Ingredient ID: NPC257272

Ingredient ID: NPC251407

Ingredient ID: NPC250981

Ingredient ID: NPC250699

Ingredient ID: NPC249407

Ingredient ID: NPC249105

Ingredient ID: NPC248056

Ingredient ID: NPC246543

Ingredient ID: NPC244061

Ingredient ID: NPC243966

Ingredient ID: NPC243728

Ingredient ID: NPC242580

Ingredient ID: NPC240572

Ingredient ID: NPC237812

Ingredient ID: NPC237801

Ingredient ID: NPC237540

Ingredient ID: NPC237532

Ingredient ID: NPC237506

Ingredient ID: NPC236709

Ingredient ID: NPC235260

Ingredient ID: NPC230301

Ingredient ID: NPC228346

Ingredient ID: NPC228249

Ingredient ID: NPC228074

Ingredient ID: NPC226453

Ingredient ID: NPC226331

Ingredient ID: NPC226027

Ingredient ID: NPC225710

Ingredient ID: NPC224389

Ingredient ID: NPC223224

Ingredient ID: NPC221751

Ingredient ID: NPC220210

Ingredient ID: NPC220007

Ingredient ID: NPC219143

Ingredient ID: NPC217052

Ingredient ID: NPC216330

Ingredient ID: NPC215924

Ingredient ID: NPC215644

Ingredient ID: NPC215055

Ingredient ID: NPC214610

Ingredient ID: NPC213876

Ingredient ID: NPC213809

Ingredient ID: NPC212670

Ingredient ID: NPC210040

Ingredient ID: NPC210003

Ingredient ID: NPC208793

Ingredient ID: NPC20791

Ingredient ID: NPC206264

Ingredient ID: NPC20505

Ingredient ID: NPC20428

Ingredient ID: NPC203500

Ingredient ID: NPC203468

Ingredient ID: NPC202762

Ingredient ID: NPC20181

Ingredient ID: NPC200819

Ingredient ID: NPC200184

Ingredient ID: NPC199072

Ingredient ID: NPC198586

Ingredient ID: NPC195305

Ingredient ID: NPC193180

Ingredient ID: NPC192638

Ingredient ID: NPC192402

Ingredient ID: NPC190454

Ingredient ID: NPC19044

Ingredient ID: NPC189853

Ingredient ID: NPC189436

Ingredient ID: NPC188334

Ingredient ID: NPC187770

Ingredient ID: NPC185755

Ingredient ID: NPC180114

Ingredient ID: NPC178777

Ingredient ID: NPC178383

Ingredient ID: NPC17810

Ingredient ID: NPC175955

Ingredient ID: NPC175236

Ingredient ID: NPC174246

Ingredient ID: NPC173471

Ingredient ID: NPC171125

Ingredient ID: NPC168653

Ingredient ID: NPC168579

Ingredient ID: NPC1682

Ingredient ID: NPC167976

Ingredient ID: NPC167400

Ingredient ID: NPC165287

Ingredient ID: NPC164614

Ingredient ID: NPC162817

Ingredient ID: NPC158537

Ingredient ID: NPC157778

Ingredient ID: NPC157193

Ingredient ID: NPC156947

Ingredient ID: NPC156654

Ingredient ID: NPC15538

Ingredient ID: NPC154172

Ingredient ID: NPC153813

Ingredient ID: NPC152451

Ingredient ID: NPC152042

Ingredient ID: NPC151981

Ingredient ID: NPC151862

Ingredient ID: NPC150958

Ingredient ID: NPC150950

Ingredient ID: NPC150427

Ingredient ID: NPC149221

Ingredient ID: NPC147983

Ingredient ID: NPC144075

Ingredient ID: NPC142703

Ingredient ID: NPC142415

Ingredient ID: NPC138489

Ingredient ID: NPC137958

Ingredient ID: NPC137949

Ingredient ID: NPC136248

Ingredient ID: NPC136014

Ingredient ID: NPC135846

Ingredient ID: NPC133852

Ingredient ID: NPC133017

Ingredient ID: NPC130683

Ingredient ID: NPC130444

Ingredient ID: NPC129795

Ingredient ID: NPC127624

Ingredient ID: NPC126681

Ingredient ID: NPC126200

Ingredient ID: NPC125755

Ingredient ID: NPC124011

Ingredient ID: NPC123474

Ingredient ID: NPC122318

Ingredient ID: NPC118361

Ingredient ID: NPC117460

Ingredient ID: NPC11722

Ingredient ID: NPC116775

Ingredient ID: NPC11666

Ingredient ID: NPC115216

Ingredient ID: NPC11433

Ingredient ID: NPC113733

Ingredient ID: NPC112890

Ingredient ID: NPC112236

Ingredient ID: NPC112147

Ingredient ID: NPC111888

Ingredient ID: NPC110899

Ingredient ID: NPC110377

Ingredient ID: NPC108862

Ingredient ID: NPC1075

Ingredient ID: NPC106561

Ingredient ID: NPC104038

Ingredient ID: NPC103833

Ingredient ID: NPC102519

Ingredient ID: NPC10146