• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Argyranthemum Frutescens


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

TCGAACCCTGCAAAGCAGAACGACCCGTGAACACGTAATAATAACCGAGCACCGAGTGGGTTAAGCGCTTTGTTTGATCCTCTCGGTGCTTTGTCGATGTGCATTTACTCGAGTCCTTTTGGGCCTTGTGAGTGTGTCATTGGCGCAATAACAACCCCCGGCACAATGCGTGCCAAGGAAAACTAAACTTAAGAAGGCTTGTTTCATGTTTGCCCCGTTCGCGGTGTGCTCATGGGATGTGGCTTCTTTATAATCACAAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO9846
Plant Latin Name: Argyranthemum Frutescens
Taxonomy Genus: Argyranthemum
Taxonomy Family: Asteraceae

Plant External Links:

NCBI TaxonomyDB: 99032
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

16 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


7 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

8 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC6208

Ingredient ID: NPC37221

Ingredient ID: NPC300564

Ingredient ID: NPC292419

Ingredient ID: NPC26536

Ingredient ID: NPC264317

Ingredient ID: NPC230301

Ingredient ID: NPC211235

Ingredient ID: NPC208639

Ingredient ID: NPC180968

Ingredient ID: NPC16973

Ingredient ID: NPC166584

Ingredient ID: NPC142415

Ingredient ID: NPC142218

Ingredient ID: NPC127365

Ingredient ID: NPC124968