• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Typha Angustifolia


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGATGCCTGACCAAGGACGACCGCGAACTCGTGAACGAACGCCGGCGGGGCGGGCACCCGCCCGTCCCGCCGGCCCTCCCCCGGCGTCCCTCTCCCCGCCCTCTCGGGCGGGTAAGGGACGACGGGGGGCACGGACGAACCCCGGCGCGACATGGCGCCAAGGAACACAAAGAGACGGAAGCGCGGGGCGCCCGCGTGCCGGGCGCCCCCGCGGCCGACCAAAATTAATACCAGATGACTCTCGGCAACGGATATCTCGGCTCTCCCATCGATGAAGAACGTAGCGAAATGCGATACCTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCTTCTGGTCGAGGGCACGCCTGCCTGGGCGTCACGCCAACGACGCTCCGCGCCCCCCGCCCGCTCGGGCGGGGCGGCGGCGGACGCGGACGATGGCCCTCCGTGCCCACGGGCGCGGCGGGCTGAAGCACGGGCCGTCGGCAGGGGCCGAGACACGGCGAGTGGTGGACGACGTTACCGTGCGCGAGCCGGACGTCGTGCCTCCGACCCCCTCCGAGGAAGGCCCTCCGGACCCCACACCGGGCGCGCGCCGCGGGACCGCGGCGCGGCCATCGGA

Click for details-----ITS1

TCGATGCCTGACCAAGGACGACCGCGAACTCGTGAACGAACGCCGGCGGGGCGGGCACCCGCCCGTCCCGCCGGCCCTCCCCCGGCGTCCCTCTCCCCGCCCTCTCGGGCGGGTAAGGGACGACGGGGGGCACGGACGAACCCCGGCGCGACATGGCGCCAAGGAACACAAAGAGACGGAAGCGCGGGGCGCCCGCGTGCCGGGCGCCCCCGCGGCCGACCAAAATTAATACCAGA

Click for details-----ITS2

CAACGACGCTCCGCGCCCCCCGCCCGCTCGGGCGGGGCGGCGGCGGACGCGGACGATGGCCCTCCGTGCCCACGGGCGCGGCGGGCTGAAGCACGGGCCGTCGGCAGGGGCCGAGACACGGCGAGTGGTGGACGACGTTACCGTGCGCGAGCCGGACGTCGTGCCTCCGACCCCCTCCGAGGAAGGCCCTCCGGACCCCACACCGGGCGCGCGCCGCGGGACCGCGGCGCGGCCATCGGA
Taxonomic Information

Plant ID: NPO9822
Plant Latin Name: Typha Angustifolia
Taxonomy Genus: Typha
Taxonomy Family: Typhaceae

Plant External Links:

NCBI TaxonomyDB: 59011
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Turkey; China; New Zealand; India

Traditional Medicine System:
Sowa-Rigpa; TCM; Unani; Ayurveda


Medicinal Functions:

Anticoagulant; Diuretic; Emmenagogue; Haemostatic; Lithontripic; Miscellany

Geographical Distribution

Turkey; India; New Zealand; China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

98 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


56 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

51 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC98871

Ingredient ID: NPC94343

Ingredient ID: NPC94167

Ingredient ID: NPC90232

Ingredient ID: NPC89052

Ingredient ID: NPC84938

Ingredient ID: NPC79943

Ingredient ID: NPC76074

Ingredient ID: NPC71339

Ingredient ID: NPC62927

Ingredient ID: NPC61198

Ingredient ID: NPC59650

Ingredient ID: NPC58387

Ingredient ID: NPC57499

Ingredient ID: NPC55412

Ingredient ID: NPC54320

Ingredient ID: NPC51438

Ingredient ID: NPC490427

Ingredient ID: NPC490424

Ingredient ID: NPC43945

Ingredient ID: NPC43246

Ingredient ID: NPC42471

Ingredient ID: NPC37282

Ingredient ID: NPC329258

Ingredient ID: NPC328447

Ingredient ID: NPC327710

Ingredient ID: NPC32441

Ingredient ID: NPC323434

Ingredient ID: NPC320736

Ingredient ID: NPC31786

Ingredient ID: NPC31551

Ingredient ID: NPC311485

Ingredient ID: NPC308586

Ingredient ID: NPC302189

Ingredient ID: NPC297048

Ingredient ID: NPC296185

Ingredient ID: NPC294815

Ingredient ID: NPC291384

Ingredient ID: NPC290613

Ingredient ID: NPC29

Ingredient ID: NPC282895

Ingredient ID: NPC277109

Ingredient ID: NPC27699

Ingredient ID: NPC276813

Ingredient ID: NPC270699

Ingredient ID: NPC269980

Ingredient ID: NPC269919

Ingredient ID: NPC261038

Ingredient ID: NPC255423

Ingredient ID: NPC252821

Ingredient ID: NPC249557

Ingredient ID: NPC249045

Ingredient ID: NPC237612

Ingredient ID: NPC230301

Ingredient ID: NPC229477

Ingredient ID: NPC226087

Ingredient ID: NPC220173

Ingredient ID: NPC219536

Ingredient ID: NPC214067

Ingredient ID: NPC211913

Ingredient ID: NPC20791

Ingredient ID: NPC191444

Ingredient ID: NPC187770

Ingredient ID: NPC185189

Ingredient ID: NPC18335

Ingredient ID: NPC17810

Ingredient ID: NPC177896

Ingredient ID: NPC173208

Ingredient ID: NPC170067

Ingredient ID: NPC1682

Ingredient ID: NPC167400

Ingredient ID: NPC163242

Ingredient ID: NPC163105

Ingredient ID: NPC156461

Ingredient ID: NPC155877

Ingredient ID: NPC150950

Ingredient ID: NPC148756

Ingredient ID: NPC14858

Ingredient ID: NPC147983

Ingredient ID: NPC147022

Ingredient ID: NPC14330

Ingredient ID: NPC139416

Ingredient ID: NPC137732

Ingredient ID: NPC136014

Ingredient ID: NPC13308

Ingredient ID: NPC132565

Ingredient ID: NPC130683

Ingredient ID: NPC128275

Ingredient ID: NPC127886

Ingredient ID: NPC126004

Ingredient ID: NPC125062

Ingredient ID: NPC119271

Ingredient ID: NPC116990

Ingredient ID: NPC116775

Ingredient ID: NPC110273

Ingredient ID: NPC104502

Ingredient ID: NPC104256

Ingredient ID: NPC103209