• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Coffea Arabica


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

NA

Click for details-----ITS2

ATCGCGTCGCCACCCCCCTCCCGCGGGGGCGGCGGAGACTGGCCTCCCGTGCCCCCGGGCGCGGCCGGCCTAAACGCGAGTCCTCGGCGGGGGACGTCACGACCAGTGGTGGTTGAGTCCCTCAACTCGAGTCCTTGTCGTGCCGTTAGACCACCCGCCGCATTCGGGGCTCCGACGACCCTGAAGAGAAGTTGCTCTCATCCAACGTC
Taxonomic Information

Plant ID: NPO9788
Plant Latin Name: Coffea Arabica
Taxonomy Genus: Coffea
Taxonomy Family: Rubiaceae

Plant External Links:

NCBI TaxonomyDB: 13443
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

79 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


55 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

60 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99734

Ingredient ID: NPC98356

Ingredient ID: NPC94167

Ingredient ID: NPC93888

Ingredient ID: NPC81010

Ingredient ID: NPC80427

Ingredient ID: NPC71141

Ingredient ID: NPC62045

Ingredient ID: NPC55412

Ingredient ID: NPC489907

Ingredient ID: NPC48623

Ingredient ID: NPC39426

Ingredient ID: NPC34908

Ingredient ID: NPC328447

Ingredient ID: NPC317120

Ingredient ID: NPC316375

Ingredient ID: NPC302857

Ingredient ID: NPC29883

Ingredient ID: NPC295644

Ingredient ID: NPC294902

Ingredient ID: NPC294548

Ingredient ID: NPC281686

Ingredient ID: NPC280254

Ingredient ID: NPC278068

Ingredient ID: NPC272614

Ingredient ID: NPC269980

Ingredient ID: NPC269919

Ingredient ID: NPC265305

Ingredient ID: NPC261831

Ingredient ID: NPC256849

Ingredient ID: NPC246358

Ingredient ID: NPC242580

Ingredient ID: NPC237812

Ingredient ID: NPC230085

Ingredient ID: NPC229415

Ingredient ID: NPC226453

Ingredient ID: NPC224389

Ingredient ID: NPC220825

Ingredient ID: NPC208793

Ingredient ID: NPC20791

Ingredient ID: NPC206095

Ingredient ID: NPC205003

Ingredient ID: NPC204932

Ingredient ID: NPC203468

Ingredient ID: NPC201284

Ingredient ID: NPC189436

Ingredient ID: NPC185755

Ingredient ID: NPC17810

Ingredient ID: NPC174246

Ingredient ID: NPC171280

Ingredient ID: NPC170509

Ingredient ID: NPC169749

Ingredient ID: NPC1682

Ingredient ID: NPC167400

Ingredient ID: NPC156840

Ingredient ID: NPC154792

Ingredient ID: NPC150950

Ingredient ID: NPC149803

Ingredient ID: NPC147983

Ingredient ID: NPC139037

Ingredient ID: NPC13818

Ingredient ID: NPC137958

Ingredient ID: NPC1363

Ingredient ID: NPC136014

Ingredient ID: NPC130683

Ingredient ID: NPC126741

Ingredient ID: NPC126681

Ingredient ID: NPC124846

Ingredient ID: NPC119133

Ingredient ID: NPC116839

Ingredient ID: NPC11433

Ingredient ID: NPC114325

Ingredient ID: NPC112890

Ingredient ID: NPC112367

Ingredient ID: NPC111888

Ingredient ID: NPC107522

Ingredient ID: NPC1075

Ingredient ID: NPC104196

Ingredient ID: NPC100980