• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Croton Sparsiflorus


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAAACCTGCATAGCAGAACGACTCGCGAACAAGTAAGATAAATCTCGGGTGACCTTTGGCGCCTTCGGGCGCCATTGAGAACCTAATGGCTAAGTCGTGTAATGCCATTAAGGCTTCTGCCTTTTTCGACATGCACTGCTTAGTCTATCAACCAACCCCGGCGCAAGACGCGCCAAGGAAAACATGAATAGAAAAAAGAAGACACGTCTGGCTGGCCCCGGCTTCGGGATCCCGGAAAGAACGTTGTCATCTTTTCATAATAAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACCGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAAGCCTTTCGGCCGAGGGCACGTCTGCCTGGGTGTCACGCAACAATGCTCCCAACCCATTTGGGTGCGGAATATGGCCTCCCGTATGATCTCCTCATGCGGTTGGCCGAAAATAATGGTCCAAGGCTGCGAATGCCGCGACAATCGGTGGTTGTAAGACCCTCGTACATAGTCGCGTGCACGCATTCCTTTGGATAACGAGACCCCTTTGCGTCCTTTGTGGCACGCTCACTTCGCGACCCCAGG

Click for details-----ITS1

TCGAAACCTGCATAGCAGAACGACTCGCGAACAAGTAAGATAAATCTCGGGTGACCTTTGGCGCCTTCGGGCGCCATTGAGAACCTAATGGCTAAGTCGTGTAATGCCATTAAGGCTTCTGCCTTTTTCGACATGCACTGCTTAGTCTATCAACCAACCCCGGCGCAAGACGCGCCAAGGAAAACATGAATAGAAAAAAGAAGACACGTCTGGCTGGCCCCGGCTTCGGGATCCCGGAAAGAACGTTGTCATCTTTTCATAATAAAAA

Click for details-----ITS2

AACAATGCTCCCAACCCATTTGGGTGCGGAATATGGCCTCCCGTATGATCTCCTCATGCGGTTGGCCGAAAATAATGGTCCAAGGCTGCGAATGCCGCGACAATCGGTGGTTGTAAGACCCTCGTACATAGTCGCGTGCACGCATTCCTTTGGATAACGAGACCCCTTTGCGTCCTTTGTGGCACGCTCACTTCGCGACCCCAGG
Taxonomic Information

Plant ID: NPO9603
Plant Latin Name: Croton Sparsiflorus
Taxonomy Genus: Croton
Taxonomy Family: Euphorbiaceae

Plant External Links:

NCBI TaxonomyDB: n.a.
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
China

Traditional Medicine System:
TCM

Geographical Distribution

China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

140 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


71 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

16 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99848

Ingredient ID: NPC9338

Ingredient ID: NPC92062

Ingredient ID: NPC90181

Ingredient ID: NPC89966

Ingredient ID: NPC89118

Ingredient ID: NPC85349

Ingredient ID: NPC74670

Ingredient ID: NPC74411

Ingredient ID: NPC73860

Ingredient ID: NPC73700

Ingredient ID: NPC72935

Ingredient ID: NPC7086

Ingredient ID: NPC68899

Ingredient ID: NPC66029

Ingredient ID: NPC65265

Ingredient ID: NPC64527

Ingredient ID: NPC6359

Ingredient ID: NPC61581

Ingredient ID: NPC59833

Ingredient ID: NPC58799

Ingredient ID: NPC58252

Ingredient ID: NPC57105

Ingredient ID: NPC54384

Ingredient ID: NPC54365

Ingredient ID: NPC51695

Ingredient ID: NPC47719

Ingredient ID: NPC44734

Ingredient ID: NPC44397

Ingredient ID: NPC41074

Ingredient ID: NPC31965

Ingredient ID: NPC311540

Ingredient ID: NPC307767

Ingredient ID: NPC302807

Ingredient ID: NPC299614

Ingredient ID: NPC289905

Ingredient ID: NPC28737

Ingredient ID: NPC28633

Ingredient ID: NPC285089

Ingredient ID: NPC283376

Ingredient ID: NPC281411

Ingredient ID: NPC281122

Ingredient ID: NPC280059

Ingredient ID: NPC279122

Ingredient ID: NPC277447

Ingredient ID: NPC271954

Ingredient ID: NPC268595

Ingredient ID: NPC267467

Ingredient ID: NPC267206

Ingredient ID: NPC267162

Ingredient ID: NPC266368

Ingredient ID: NPC265658

Ingredient ID: NPC259399

Ingredient ID: NPC257750

Ingredient ID: NPC257390

Ingredient ID: NPC255315

Ingredient ID: NPC255104

Ingredient ID: NPC255058

Ingredient ID: NPC253703

Ingredient ID: NPC253129

Ingredient ID: NPC24776

Ingredient ID: NPC246929

Ingredient ID: NPC243976

Ingredient ID: NPC242717

Ingredient ID: NPC242275

Ingredient ID: NPC241121

Ingredient ID: NPC238598

Ingredient ID: NPC236795

Ingredient ID: NPC236346

Ingredient ID: NPC233919

Ingredient ID: NPC233147

Ingredient ID: NPC230166

Ingredient ID: NPC229361

Ingredient ID: NPC226621

Ingredient ID: NPC225258

Ingredient ID: NPC224324

Ingredient ID: NPC223816

Ingredient ID: NPC220501

Ingredient ID: NPC220257

Ingredient ID: NPC217616

Ingredient ID: NPC215609

Ingredient ID: NPC214368

Ingredient ID: NPC21106

Ingredient ID: NPC210312

Ingredient ID: NPC209265

Ingredient ID: NPC209159

Ingredient ID: NPC208201

Ingredient ID: NPC208157

Ingredient ID: NPC208090

Ingredient ID: NPC206051

Ingredient ID: NPC201066

Ingredient ID: NPC200085

Ingredient ID: NPC198855

Ingredient ID: NPC197274

Ingredient ID: NPC192241

Ingredient ID: NPC188906

Ingredient ID: NPC188387

Ingredient ID: NPC188232

Ingredient ID: NPC18123

Ingredient ID: NPC170767

Ingredient ID: NPC169499

Ingredient ID: NPC168103

Ingredient ID: NPC167918

Ingredient ID: NPC166467

Ingredient ID: NPC164044

Ingredient ID: NPC162080

Ingredient ID: NPC160952

Ingredient ID: NPC159771

Ingredient ID: NPC155990

Ingredient ID: NPC155470

Ingredient ID: NPC154047

Ingredient ID: NPC148304

Ingredient ID: NPC144305

Ingredient ID: NPC143818

Ingredient ID: NPC140931

Ingredient ID: NPC140874

Ingredient ID: NPC139306

Ingredient ID: NPC134102

Ingredient ID: NPC134093

Ingredient ID: NPC133255

Ingredient ID: NPC130821

Ingredient ID: NPC129982

Ingredient ID: NPC129310

Ingredient ID: NPC129251

Ingredient ID: NPC129

Ingredient ID: NPC128455

Ingredient ID: NPC123980

Ingredient ID: NPC120498

Ingredient ID: NPC117271

Ingredient ID: NPC115659

Ingredient ID: NPC114281

Ingredient ID: NPC113923

Ingredient ID: NPC11267

Ingredient ID: NPC111449

Ingredient ID: NPC109690

Ingredient ID: NPC108847

Ingredient ID: NPC108197

Ingredient ID: NPC106471

Ingredient ID: NPC103557

Ingredient ID: NPC100891