• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Gnetum Latifolium


Example Image
PLANiTS DNA barcode

Click for details-----ITS

AGGTGAACCTGCGGTAGGATCATTGACGTTGTGTCGCACGTTCGACGGATCGATGGCACGCCACATCGATCCGGAGCGTTCGAGGGGAGGGGTTGCCCTCCCGATGGAGGACGACGTGTGGCCGTCGTCCGTCGAGGATAGGCGGGGAGATGCTCGCTTCGGGGGGTGGCGGCCCGCGAAGGCATCGTGAGAAAGTCGTGGAGCTCTACGTTCGCGGTCGGTGAGCCCGTGGCAAGCAGCCTAAGGGCTGCACGCGAGGGGGACATACGAGGGCCGCGCTTTCCTTCCCCGGGTGGTCCCGCGGGAGGGAGGGGATAAGACGCGATGCGCTAGGGTGCGAGTGGCACCAAAGGATGCGACGAACGTCCGCCGCGGCGGTCAAACGGGGTCGGTGACCCCAACCACGACTCTCGACAATGGATTCTCGGCTCTCGCTTCGATGAAGAACGTAGCGAAATGCGACACTTTGTGTGAATTGCAGAATCCCGTGAATCATCGAATCTTTGAACGCAAGTTGCGCCCGAGGCCCTAGGTCGAGGGCACGTCTGGCTGGGTGTGGTGATGAAAGATCCCACGGCGCGCCCTCCTCGCCGCGTGCGAGGGGGGCAGCGGATGTGGTCGTCCGTGTCCTCTCGAGGTGCGGTCGGCTGAAATGTTGCCGTCGTTCGTGTATTTTGGCTTCTCCCCGAACGGAGCGATGGATGGTGGTGGCGGTCTGTGCGTTCCCTGCGCCGAGCGCGCACGAGGTACGTTGGCCGCCTCCCCGCCCTTCTCCTTCGGGGCGATGCGATGCCCGTGCGACCGGCGGGGGCGATGTCCGTCCTGTGCGTCGCGCACGGGAGGGGTGGTGCTCCCTCTTCG

Click for details-----ITS1

ACCGTAGGTGAACCTACGGTAGGATCATTGACGTTGTGTCACACCTTCGACAGATCGATGGCACGCCACATCGATCCGGAGCATTCGAGGGAGGGGTTGCCTCCCGATGGAGGACGTGCAGCCATCGTCCATCGAGGATAGGTGGGGAGATGCTCGCTTCGGGGGGTGGCAGCCCGCGAAGGCATCATGAGAAAGTTGTGGAGCTCTATGTTTGTGGTCGGTGAGCCCGTGGCAAGTCGCCTAAGGGCTGCACGCGAGGGGGACATACGAGGGCCACTCTTTCCTTCCCCGGGTCACCACCCGGTCCCGCAGGAGGGAGGGGATAAGACGCGATGCGCTAGGATGCAAGTGGCACCAAGGATGCGACAAACGTCCACCGCGGCGGTTAAATGGGGTCGGTGACCCCAACCA

Click for details-----ITS2

GTGATGAAAGATCCCACGGCGCGCCCTCCTCGCCGCGTGCGAGGGGGGCAGCGGATGTGGTCGTCCGTGTCCTCTCGAGGTGCGGTCGGCTGAAATGTTGCCGTCGTTCGTGTATTTTGGCTTCTCCCCGAACGGAGCGATGGATGGTGGTGGCGGTCTGTGCGTTCCCTGCGCCGAGCGCGCACGAGGTACGTTGGCCGCCTCCCCGCCCTTCTCCTTCGGGGCGATGCGATGCCCGTGCGACCGGCGGGGGCGATGTCCGTCCTGTGCGTCGCGCACGGGAGGGGTGGTGCTCCCTCTTCG
Taxonomic Information

Plant ID: NPO9516
Plant Latin Name: Gnetum Latifolium
Taxonomy Genus: Gnetum
Taxonomy Family: Gnetaceae

Plant External Links:

NCBI TaxonomyDB: 225592
Plant-of-the-World-Online: 383530-1

Used in Medicines

Country/Region:
Thailand; China

Traditional Medicine System:
TCM

Geographical Distribution

Australia; Bangladesh; Myanmar; Philippines; Indonesia; India; Cambodia; Vietnam; China; Papua New Guinea; Laos; Thailand

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

261 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


63 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

88 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99088

Ingredient ID: NPC99069

Ingredient ID: NPC98583

Ingredient ID: NPC97578

Ingredient ID: NPC97444

Ingredient ID: NPC96403

Ingredient ID: NPC96229

Ingredient ID: NPC93155

Ingredient ID: NPC92999

Ingredient ID: NPC9259

Ingredient ID: NPC92338

Ingredient ID: NPC91957

Ingredient ID: NPC91431

Ingredient ID: NPC90643

Ingredient ID: NPC88391

Ingredient ID: NPC87061

Ingredient ID: NPC86856

Ingredient ID: NPC85799

Ingredient ID: NPC85345

Ingredient ID: NPC81870

Ingredient ID: NPC81803

Ingredient ID: NPC81010

Ingredient ID: NPC76939

Ingredient ID: NPC76733

Ingredient ID: NPC76241

Ingredient ID: NPC76078

Ingredient ID: NPC75467

Ingredient ID: NPC74238

Ingredient ID: NPC73959

Ingredient ID: NPC73666

Ingredient ID: NPC7300

Ingredient ID: NPC71686

Ingredient ID: NPC70367

Ingredient ID: NPC6702

Ingredient ID: NPC66812

Ingredient ID: NPC65142

Ingredient ID: NPC64381

Ingredient ID: NPC62965

Ingredient ID: NPC61990

Ingredient ID: NPC61446

Ingredient ID: NPC59692

Ingredient ID: NPC59005

Ingredient ID: NPC58350

Ingredient ID: NPC58190

Ingredient ID: NPC57788

Ingredient ID: NPC56340

Ingredient ID: NPC55917

Ingredient ID: NPC54653

Ingredient ID: NPC5360

Ingredient ID: NPC50364

Ingredient ID: NPC47941

Ingredient ID: NPC477186

Ingredient ID: NPC477185

Ingredient ID: NPC45782

Ingredient ID: NPC44892

Ingredient ID: NPC44209

Ingredient ID: NPC43381

Ingredient ID: NPC42683

Ingredient ID: NPC41748

Ingredient ID: NPC39351

Ingredient ID: NPC38851

Ingredient ID: NPC37793

Ingredient ID: NPC37725

Ingredient ID: NPC37644

Ingredient ID: NPC37393

Ingredient ID: NPC34864

Ingredient ID: NPC34763

Ingredient ID: NPC34125

Ingredient ID: NPC32807

Ingredient ID: NPC32643

Ingredient ID: NPC313179

Ingredient ID: NPC312800

Ingredient ID: NPC311233

Ingredient ID: NPC307147

Ingredient ID: NPC307064

Ingredient ID: NPC306159

Ingredient ID: NPC305471

Ingredient ID: NPC303646

Ingredient ID: NPC303422

Ingredient ID: NPC302877

Ingredient ID: NPC302787

Ingredient ID: NPC301221

Ingredient ID: NPC300326

Ingredient ID: NPC29883

Ingredient ID: NPC297848

Ingredient ID: NPC296058

Ingredient ID: NPC295314

Ingredient ID: NPC295230

Ingredient ID: NPC294558

Ingredient ID: NPC293378

Ingredient ID: NPC293194

Ingredient ID: NPC291938

Ingredient ID: NPC291308

Ingredient ID: NPC289322

Ingredient ID: NPC288413

Ingredient ID: NPC28569

Ingredient ID: NPC2856

Ingredient ID: NPC285472

Ingredient ID: NPC284107

Ingredient ID: NPC280673

Ingredient ID: NPC279406

Ingredient ID: NPC278299

Ingredient ID: NPC278102

Ingredient ID: NPC277867

Ingredient ID: NPC276407

Ingredient ID: NPC276052

Ingredient ID: NPC275759

Ingredient ID: NPC274875

Ingredient ID: NPC27373

Ingredient ID: NPC270698

Ingredient ID: NPC270578

Ingredient ID: NPC268266

Ingredient ID: NPC268079

Ingredient ID: NPC267296

Ingredient ID: NPC26474

Ingredient ID: NPC264679

Ingredient ID: NPC263940

Ingredient ID: NPC263233

Ingredient ID: NPC26080

Ingredient ID: NPC260491

Ingredient ID: NPC260342

Ingredient ID: NPC259722

Ingredient ID: NPC256623

Ingredient ID: NPC252074

Ingredient ID: NPC249191

Ingredient ID: NPC248943

Ingredient ID: NPC248573

Ingredient ID: NPC248394

Ingredient ID: NPC24642

Ingredient ID: NPC246202

Ingredient ID: NPC243728

Ingredient ID: NPC242107

Ingredient ID: NPC242028

Ingredient ID: NPC238254

Ingredient ID: NPC236997

Ingredient ID: NPC236709

Ingredient ID: NPC236264

Ingredient ID: NPC236202

Ingredient ID: NPC235469

Ingredient ID: NPC235341

Ingredient ID: NPC235260

Ingredient ID: NPC234905

Ingredient ID: NPC234719

Ingredient ID: NPC234578

Ingredient ID: NPC234489

Ingredient ID: NPC233467

Ingredient ID: NPC233388

Ingredient ID: NPC231926

Ingredient ID: NPC230301

Ingredient ID: NPC22941

Ingredient ID: NPC228496

Ingredient ID: NPC226809

Ingredient ID: NPC226304

Ingredient ID: NPC225977

Ingredient ID: NPC225863

Ingredient ID: NPC224921

Ingredient ID: NPC224297

Ingredient ID: NPC224205

Ingredient ID: NPC223654

Ingredient ID: NPC222692

Ingredient ID: NPC219876

Ingredient ID: NPC216980

Ingredient ID: NPC216219

Ingredient ID: NPC21570

Ingredient ID: NPC215135

Ingredient ID: NPC214910

Ingredient ID: NPC213968

Ingredient ID: NPC213607

Ingredient ID: NPC212387

Ingredient ID: NPC209779

Ingredient ID: NPC20791

Ingredient ID: NPC207516

Ingredient ID: NPC204932

Ingredient ID: NPC203230

Ingredient ID: NPC202742

Ingredient ID: NPC201562

Ingredient ID: NPC201170

Ingredient ID: NPC198031

Ingredient ID: NPC196817

Ingredient ID: NPC196791

Ingredient ID: NPC195355

Ingredient ID: NPC194376

Ingredient ID: NPC19427

Ingredient ID: NPC19388

Ingredient ID: NPC193541

Ingredient ID: NPC193078

Ingredient ID: NPC189620

Ingredient ID: NPC188899

Ingredient ID: NPC188847

Ingredient ID: NPC187676

Ingredient ID: NPC186518

Ingredient ID: NPC185230

Ingredient ID: NPC183523

Ingredient ID: NPC18185

Ingredient ID: NPC180508

Ingredient ID: NPC180144

Ingredient ID: NPC179950

Ingredient ID: NPC179789

Ingredient ID: NPC179702

Ingredient ID: NPC17810

Ingredient ID: NPC178059

Ingredient ID: NPC177941

Ingredient ID: NPC176025

Ingredient ID: NPC175378

Ingredient ID: NPC171794

Ingredient ID: NPC170016

Ingredient ID: NPC169749

Ingredient ID: NPC169468

Ingredient ID: NPC168579

Ingredient ID: NPC165686

Ingredient ID: NPC165136

Ingredient ID: NPC164622

Ingredient ID: NPC164487

Ingredient ID: NPC163091

Ingredient ID: NPC163090

Ingredient ID: NPC161700

Ingredient ID: NPC161571

Ingredient ID: NPC160512

Ingredient ID: NPC159664

Ingredient ID: NPC15962

Ingredient ID: NPC159095

Ingredient ID: NPC158540

Ingredient ID: NPC15658

Ingredient ID: NPC154656

Ingredient ID: NPC154362

Ingredient ID: NPC152127

Ingredient ID: NPC15109

Ingredient ID: NPC150670

Ingredient ID: NPC149209

Ingredient ID: NPC147934

Ingredient ID: NPC147155

Ingredient ID: NPC147020

Ingredient ID: NPC146972

Ingredient ID: NPC146953

Ingredient ID: NPC14442

Ingredient ID: NPC143852

Ingredient ID: NPC1429

Ingredient ID: NPC142415

Ingredient ID: NPC142153

Ingredient ID: NPC137634

Ingredient ID: NPC136473

Ingredient ID: NPC136064

Ingredient ID: NPC134140

Ingredient ID: NPC133671

Ingredient ID: NPC133209

Ingredient ID: NPC131957

Ingredient ID: NPC126791

Ingredient ID: NPC126029

Ingredient ID: NPC125755

Ingredient ID: NPC125579

Ingredient ID: NPC124295

Ingredient ID: NPC122306

Ingredient ID: NPC118752

Ingredient ID: NPC11727

Ingredient ID: NPC114179

Ingredient ID: NPC1135

Ingredient ID: NPC113366

Ingredient ID: NPC11128

Ingredient ID: NPC111134

Ingredient ID: NPC108811

Ingredient ID: NPC108303