• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Papaver Somniferum


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAAACCTGCCCAGCAGAACGACCCGCGAACACGTGAATCCAAGTCCAGTGGTGGTGCAAGTGGGGAGAGATCCCCCTTGCTCCACCGCTCGGTCGGGGAGTTGGCTAACACCCTCTCTTTGTGCCGGAAAACGAACCCAAGGCGCGGTGAGCGCCAAGGAAAAAACAAATGGATGCTAGCGGGCCTCTTCTCTTTCTCCTGCCTCGGTGGGAAAAATGCAGCGGTAGGTGTCGCGAAATCCTATCTTCGAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCCAAGCCTTCGGGCCGAGGGCACGCTTGCCTGGGCGTCACGCACCGAGTCTCCCCCTCCAACTCATGTCCTTGGCGCCTTCTGGCGACATTGGCATTGGGCAGTGAATGNGGAGGACATTGACCCCCCGTGCCTTTAAAGTGCGGTCGGTCTAAACACAGGCCCTGGGAGGCCGGCGTCACGATTCGTGGTGGTCGACACTCGTTGTCTCTCTTCATTCCTGAATCCGTGTCTGCTGTGCTTACCGTGAAGGACCATAAGGAACCCATCGGGCCATAAATATGGCACCCACTCTGCGACCCCAGGTCAAGCGGGACTAC

Click for details-----ITS1

TCGAAACCTGCAAAGCAGAACGACCCGCGAACAAGTGAACCCAAGTTCAGTGGTGATGCAGGTGGGGAGAGATCCCCCCTTGCTCCACCGCTCGGTCGGGGAGTTGGCTAACGCCCTCTCTTCGTGCCGAAAAACGAACCCAAGGCGCGGCAAGCGCCAAGGAAAAAACAAATGGATGCTAGCGTTCCTATTCTCTTTCTCCTGCCCCGGTGGGGAAAATGCAGCGTACGGCGTGGCGAGATCCGATCTTCGAA

Click for details-----ITS2

ACCGAGTCTCCCCCTCCAACTCATGTCCTTGGCGCCTTCTGGCGACATTGGCATTGGGCAGTGAATGNGGAGGACATTGACCCCCCGTGCCTTTAAAGTGCGGTCGGTCTAAACACAGGCCCTGGGAGGCCGGCGTCACGATTCGTGGTGGTCGACACTCGTTGTCTCTCTTCATTCCTGAATCCGTGTCTGCTGTGCTTACCGTGAAGGACCATAAGGAACCCATCGGGCCATAAATATGGCACCCACTCTGCGACCCCAGGTCAAGCGGGACTAC
Taxonomic Information

Plant ID: NPO9498
Plant Latin Name: Papaver Somniferum
Taxonomy Genus: Papaver
Taxonomy Family: Papaveraceae

Plant External Links:

NCBI TaxonomyDB: 3469
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Turkey; Italy; Indonesia; India; Vietnam; China; Thailand; South Korea; Iraq

Traditional Medicine System:
Indian Folk; Unani; Siddha; Ayurveda; TCM; Homeopathy


Medicinal Functions:

Anodyne; Antispasmodic; Antitussive; Astringent; Diaphoretic; Emmenagogue; Expectorant; Homeopathy; Hypnotic; Narcotic; Sedative

Geographical Distribution

Turkey; Italy; Indonesia; India; Vietnam; China; Thailand; South Korea; Iraq

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

289 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


226 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

145 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99681

Ingredient ID: NPC99659

Ingredient ID: NPC97086

Ingredient ID: NPC95950

Ingredient ID: NPC94167

Ingredient ID: NPC93888

Ingredient ID: NPC92707

Ingredient ID: NPC91511

Ingredient ID: NPC91358

Ingredient ID: NPC89769

Ingredient ID: NPC88278

Ingredient ID: NPC88249

Ingredient ID: NPC86961

Ingredient ID: NPC86469

Ingredient ID: NPC85813

Ingredient ID: NPC85346

Ingredient ID: NPC8305

Ingredient ID: NPC82301

Ingredient ID: NPC81010

Ingredient ID: NPC79378

Ingredient ID: NPC76274

Ingredient ID: NPC76217

Ingredient ID: NPC7449

Ingredient ID: NPC74436

Ingredient ID: NPC74368

Ingredient ID: NPC73512

Ingredient ID: NPC73504

Ingredient ID: NPC72312

Ingredient ID: NPC71649

Ingredient ID: NPC70075

Ingredient ID: NPC68133

Ingredient ID: NPC67346

Ingredient ID: NPC66909

Ingredient ID: NPC66177

Ingredient ID: NPC64576

Ingredient ID: NPC63649

Ingredient ID: NPC62045

Ingredient ID: NPC60151

Ingredient ID: NPC59907

Ingredient ID: NPC59650

Ingredient ID: NPC55600

Ingredient ID: NPC54733

Ingredient ID: NPC54379

Ingredient ID: NPC54273

Ingredient ID: NPC53601

Ingredient ID: NPC53028

Ingredient ID: NPC52410

Ingredient ID: NPC490427

Ingredient ID: NPC490424

Ingredient ID: NPC490334

Ingredient ID: NPC489908

Ingredient ID: NPC489907

Ingredient ID: NPC48637

Ingredient ID: NPC48623

Ingredient ID: NPC46935

Ingredient ID: NPC46451

Ingredient ID: NPC45955

Ingredient ID: NPC45328

Ingredient ID: NPC44953

Ingredient ID: NPC43726

Ingredient ID: NPC43069

Ingredient ID: NPC428

Ingredient ID: NPC41323

Ingredient ID: NPC40857

Ingredient ID: NPC4053

Ingredient ID: NPC4040

Ingredient ID: NPC39652

Ingredient ID: NPC38407

Ingredient ID: NPC37144

Ingredient ID: NPC35041

Ingredient ID: NPC33415

Ingredient ID: NPC33179

Ingredient ID: NPC32950

Ingredient ID: NPC328788

Ingredient ID: NPC328750

Ingredient ID: NPC328700

Ingredient ID: NPC328447

Ingredient ID: NPC328423

Ingredient ID: NPC327766

Ingredient ID: NPC325871

Ingredient ID: NPC323443

Ingredient ID: NPC32169

Ingredient ID: NPC32141

Ingredient ID: NPC319632

Ingredient ID: NPC317381

Ingredient ID: NPC317120

Ingredient ID: NPC315274

Ingredient ID: NPC314828

Ingredient ID: NPC313955

Ingredient ID: NPC31385

Ingredient ID: NPC310909

Ingredient ID: NPC309749

Ingredient ID: NPC308267

Ingredient ID: NPC307739

Ingredient ID: NPC307065

Ingredient ID: NPC305847

Ingredient ID: NPC305440

Ingredient ID: NPC303581

Ingredient ID: NPC303225

Ingredient ID: NPC302449

Ingredient ID: NPC302378

Ingredient ID: NPC301586

Ingredient ID: NPC301340

Ingredient ID: NPC300505

Ingredient ID: NPC29883

Ingredient ID: NPC298343

Ingredient ID: NPC297670

Ingredient ID: NPC294902

Ingredient ID: NPC294548

Ingredient ID: NPC293378

Ingredient ID: NPC293221

Ingredient ID: NPC290003

Ingredient ID: NPC287301

Ingredient ID: NPC285875

Ingredient ID: NPC28533

Ingredient ID: NPC282895

Ingredient ID: NPC281686

Ingredient ID: NPC280749

Ingredient ID: NPC279148

Ingredient ID: NPC277025

Ingredient ID: NPC276930

Ingredient ID: NPC275316

Ingredient ID: NPC274415

Ingredient ID: NPC272614

Ingredient ID: NPC270908

Ingredient ID: NPC270416

Ingredient ID: NPC269980

Ingredient ID: NPC269919

Ingredient ID: NPC269751

Ingredient ID: NPC268763

Ingredient ID: NPC26746

Ingredient ID: NPC265146

Ingredient ID: NPC265000

Ingredient ID: NPC262786

Ingredient ID: NPC261831

Ingredient ID: NPC259665

Ingredient ID: NPC258640

Ingredient ID: NPC257182

Ingredient ID: NPC256837

Ingredient ID: NPC255607

Ingredient ID: NPC254672

Ingredient ID: NPC254045

Ingredient ID: NPC253098

Ingredient ID: NPC253032

Ingredient ID: NPC25294

Ingredient ID: NPC250348

Ingredient ID: NPC249998

Ingredient ID: NPC249797

Ingredient ID: NPC248956

Ingredient ID: NPC247684

Ingredient ID: NPC246587

Ingredient ID: NPC244701

Ingredient ID: NPC244458

Ingredient ID: NPC244300

Ingredient ID: NPC243728

Ingredient ID: NPC243483

Ingredient ID: NPC242580

Ingredient ID: NPC24233

Ingredient ID: NPC24219

Ingredient ID: NPC241498

Ingredient ID: NPC238919

Ingredient ID: NPC237812

Ingredient ID: NPC235802

Ingredient ID: NPC233780

Ingredient ID: NPC23347

Ingredient ID: NPC232533

Ingredient ID: NPC23127

Ingredient ID: NPC230831

Ingredient ID: NPC230301

Ingredient ID: NPC228040

Ingredient ID: NPC226453

Ingredient ID: NPC226027

Ingredient ID: NPC224651

Ingredient ID: NPC222717

Ingredient ID: NPC219913

Ingredient ID: NPC219818

Ingredient ID: NPC219143

Ingredient ID: NPC2173

Ingredient ID: NPC21519

Ingredient ID: NPC214770

Ingredient ID: NPC214629

Ingredient ID: NPC214522

Ingredient ID: NPC213876

Ingredient ID: NPC213206

Ingredient ID: NPC211608

Ingredient ID: NPC211105

Ingredient ID: NPC209177

Ingredient ID: NPC208793

Ingredient ID: NPC207786

Ingredient ID: NPC207757

Ingredient ID: NPC2073

Ingredient ID: NPC206442

Ingredient ID: NPC206012

Ingredient ID: NPC20589

Ingredient ID: NPC203778

Ingredient ID: NPC203468

Ingredient ID: NPC202771

Ingredient ID: NPC201777

Ingredient ID: NPC201055

Ingredient ID: NPC200325

Ingredient ID: NPC198763

Ingredient ID: NPC197284

Ingredient ID: NPC196776

Ingredient ID: NPC196358

Ingredient ID: NPC195268

Ingredient ID: NPC193949

Ingredient ID: NPC190934

Ingredient ID: NPC190892

Ingredient ID: NPC188163

Ingredient ID: NPC187770

Ingredient ID: NPC185755

Ingredient ID: NPC18306

Ingredient ID: NPC180756

Ingredient ID: NPC178790

Ingredient ID: NPC178485

Ingredient ID: NPC176862

Ingredient ID: NPC176548

Ingredient ID: NPC176045

Ingredient ID: NPC175805

Ingredient ID: NPC175342

Ingredient ID: NPC174783

Ingredient ID: NPC174246

Ingredient ID: NPC174237

Ingredient ID: NPC173000

Ingredient ID: NPC171308

Ingredient ID: NPC167400

Ingredient ID: NPC164044

Ingredient ID: NPC163601

Ingredient ID: NPC162742

Ingredient ID: NPC160842

Ingredient ID: NPC160593

Ingredient ID: NPC158376

Ingredient ID: NPC157958

Ingredient ID: NPC154792

Ingredient ID: NPC153552

Ingredient ID: NPC152451

Ingredient ID: NPC151470

Ingredient ID: NPC150950

Ingredient ID: NPC150540

Ingredient ID: NPC149803

Ingredient ID: NPC149379

Ingredient ID: NPC147983

Ingredient ID: NPC147807

Ingredient ID: NPC147776

Ingredient ID: NPC147390

Ingredient ID: NPC147161

Ingredient ID: NPC146976

Ingredient ID: NPC146628

Ingredient ID: NPC144092

Ingredient ID: NPC143927

Ingredient ID: NPC140577

Ingredient ID: NPC137958

Ingredient ID: NPC137567

Ingredient ID: NPC136014

Ingredient ID: NPC135538

Ingredient ID: NPC135537

Ingredient ID: NPC135299

Ingredient ID: NPC133961

Ingredient ID: NPC133140

Ingredient ID: NPC131901

Ingredient ID: NPC130683

Ingredient ID: NPC126859

Ingredient ID: NPC126681

Ingredient ID: NPC126424

Ingredient ID: NPC126211

Ingredient ID: NPC124802

Ingredient ID: NPC124657

Ingredient ID: NPC124336

Ingredient ID: NPC122563

Ingredient ID: NPC121400

Ingredient ID: NPC120649

Ingredient ID: NPC119818

Ingredient ID: NPC118214

Ingredient ID: NPC116392

Ingredient ID: NPC115906

Ingredient ID: NPC11433

Ingredient ID: NPC113733

Ingredient ID: NPC113212

Ingredient ID: NPC112890

Ingredient ID: NPC112181

Ingredient ID: NPC111938

Ingredient ID: NPC111888

Ingredient ID: NPC109800

Ingredient ID: NPC109308

Ingredient ID: NPC107638

Ingredient ID: NPC1075

Ingredient ID: NPC10636

Ingredient ID: NPC103094

Ingredient ID: NPC100774