• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Tiliacora Triandra


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

NA

Click for details-----ITS2

GACGCGCCACACCCAACCCACGTCGTAACGTGGGAGGGGAGTGGAGATTGGCCTCCCGCGACCAGCGCACGGTTGGCTGAAATGATTCCCCCGGTGCCTCGACGACGCGATCAGTGGTGGTTGACGAGACCCCTTCGCGAACGAGTGACGCGATCGCTCGAGCGCTCGTGGGGGACGTGGTACCCTCGTACGTTCTATACC
Taxonomic Information

Plant ID: NPO941
Plant Latin Name: Tiliacora Triandra
Taxonomy Genus: Tiliacora
Taxonomy Family: Menispermaceae

Plant External Links:

NCBI TaxonomyDB: n.a.
Plant-of-the-World-Online: 581568-1

Used in Medicines

Country/Region:
Thailand

Traditional Medicine System:

Geographical Distribution

Thailand

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

30 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


15 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

23 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC95804

Ingredient ID: NPC84319

Ingredient ID: NPC71074

Ingredient ID: NPC69627

Ingredient ID: NPC65312

Ingredient ID: NPC61543

Ingredient ID: NPC60014

Ingredient ID: NPC5891

Ingredient ID: NPC51700

Ingredient ID: NPC44166

Ingredient ID: NPC32407

Ingredient ID: NPC302584

Ingredient ID: NPC296727

Ingredient ID: NPC256124

Ingredient ID: NPC242350

Ingredient ID: NPC241964

Ingredient ID: NPC237503

Ingredient ID: NPC232851

Ingredient ID: NPC231063

Ingredient ID: NPC192638

Ingredient ID: NPC187288

Ingredient ID: NPC185547

Ingredient ID: NPC173089

Ingredient ID: NPC150147

Ingredient ID: NPC142415

Ingredient ID: NPC139783

Ingredient ID: NPC128608

Ingredient ID: NPC123196

Ingredient ID: NPC110139

Ingredient ID: NPC108709