• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Morus Mongolica


Example Image
PLANiTS DNA barcode

Click for details-----ITS

ACAACACCCAGGGGTGACCCCAACCCCTGACGCTTGAGTGTGTGCAGCCCTGCCTTGCGCCCTCAGCATAAAATCGAACCCCAGGGCGCGGGAACGGCGTCCAAGGAATCATAACGAAACGAGCTCCTGCCGTGGCCCCGGGGACGGTGATCGCCACAAGCAGCTGTGTTGTGCTTGGTTAAGTCTAAAATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAAGTTGCGCCTGAAGCCATCAGGCTGAGGGCACGTCTGCCTGGGCGTCAAACACCGATGCCCCCCCAAATCCCCTCGTCACTCTCCCCTGAGTGCCCGGGGAGTGTGGGGGTCGGATGATGGCCTCCCGTGTCTTGGCTCGCGGTTGGCCCAAAGTCGAGTCCTCGGTCACGGTTACCGTGGTGACAGGTGGTTGTCGGTCGCTCGGTACCCCGTCACGTGCGCCGGACACGAATCGAGACTCTCTTGATTACCCCAACGCATCCCCGTTTGGGTGCCTCTG

Click for details-----ITS1

TCGAAACCTGCAAAGCAGAAAGACCAGCGGACCCATTACAACACCCAGGGGTGATTCCAACCCCTGACGCTGAGTGTGTGCGGCCCTGCCTTGCGCCCTCAGCATAAAACGAACCCAGGCGCGGAACGCGTCAAGGAATCATAACGAAACGAGCTCCTGCCGTGGCCCCGGGGACGGTGATCGCCGCAGCAGCTGTGTTGTGCTTGGTTAAGTCTAAAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO9402
Plant Latin Name: Morus Mongolica
Taxonomy Genus: Morus
Taxonomy Family: Moraceae

Plant External Links:

NCBI TaxonomyDB: 229049
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
China

Traditional Medicine System:
TCM


Medicinal Functions:

Miscellany

Geographical Distribution

China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

50 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


24 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

29 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC96565

Ingredient ID: NPC90949

Ingredient ID: NPC84266

Ingredient ID: NPC78335

Ingredient ID: NPC76336

Ingredient ID: NPC73899

Ingredient ID: NPC69200

Ingredient ID: NPC62840

Ingredient ID: NPC53640

Ingredient ID: NPC474276

Ingredient ID: NPC39306

Ingredient ID: NPC35412

Ingredient ID: NPC312208

Ingredient ID: NPC311574

Ingredient ID: NPC303633

Ingredient ID: NPC297531

Ingredient ID: NPC294344

Ingredient ID: NPC293852

Ingredient ID: NPC292233

Ingredient ID: NPC288458

Ingredient ID: NPC284876

Ingredient ID: NPC282923

Ingredient ID: NPC282046

Ingredient ID: NPC277369

Ingredient ID: NPC267552

Ingredient ID: NPC264932

Ingredient ID: NPC251336

Ingredient ID: NPC243728

Ingredient ID: NPC236937

Ingredient ID: NPC236606

Ingredient ID: NPC230713

Ingredient ID: NPC228296

Ingredient ID: NPC222779

Ingredient ID: NPC215451

Ingredient ID: NPC195136

Ingredient ID: NPC186965

Ingredient ID: NPC172687

Ingredient ID: NPC170169

Ingredient ID: NPC161650

Ingredient ID: NPC158270

Ingredient ID: NPC155246

Ingredient ID: NPC142308

Ingredient ID: NPC141765

Ingredient ID: NPC134022

Ingredient ID: NPC133898

Ingredient ID: NPC133065

Ingredient ID: NPC131685

Ingredient ID: NPC115003

Ingredient ID: NPC113212

Ingredient ID: NPC107546