CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Heliomeris Multiflora

Example Image

PLANiTS DNA barcode

Click for details-----ITS

TCGAACCCTGCACAGCAGAACGACCCGTGAACAAGTTAACACATCTGGCCTTGCTGGGACCGAAGCATTTGTTTCGACCCTCGTGAGGCCTTGTTGACGTGCGTTCGTGTCTGGCCCATACATTTGGGCTGCCCATGGATGTCATGTTRACGCAATAACAAACCCCCGGCACGAGACGTGCCAAGGAAAACCAAACTTAAAGGGCCCGTGCTATTGCGCCCCGCTTGCGGTGTGCGCGTTGGACGTGGCTTCTTTGTAAACTTAAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATCCGGTTGAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCGCCCCCACCAAGCATCCCTTCATGGGATGTCTTGTGTTGGGGCGGAGATTGGTCTCCCGTGCCCATGGTGCGGTTGGCCTAAATAGGAGTCTCCTCACGAGGGACGCACGACTAGTGGTGGTTGATAAGACTGTCGTCTCGTGTCGTGCGTTTCCTTTCTTGAGTGCATATGCTCTTAAAGTACCCCGATGCGTTGTCTTACGATGATGCTTCGA

Click for details-----ITS1

Click for details-----ITS2

ATCACGTCGCCCCCACCAAGCATCCCTTCATGGGATGTCTTGTGTTGGGGCGGAGATTGGTCTCCCGTGCCCATGGTGCGGTTGGCCTAAATAGGAGTCTCCTCACGAGGGACGCACGACTAGTGGTGGTTGATAAGACTGTCGTCTCGTGTCGTGCGTTTCCTTTCTTGAGTGCATATGCTCTTAAAGTACCCCGATGCGTTGTCTTACGATGATGCTTCGA

Taxonomic Information

Plant ID: NPO9388
Plant Latin Name: Heliomeris Multiflora
Taxonomy Genus: Heliomeris
Taxonomy Family: Asteraceae

Plant External Links:

NCBI TaxonomyDB: 191163
Plant-of-the-World-Online: n.a.

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

76 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

15 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

22 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC98508

Ingredient ID: NPC98204

Ingredient ID: NPC96604

Ingredient ID: NPC92120

Ingredient ID: NPC87558

Ingredient ID: NPC84319

Ingredient ID: NPC71074

Ingredient ID: NPC71056

Ingredient ID: NPC69361

Ingredient ID: NPC61733

Ingredient ID: NPC58190

Ingredient ID: NPC538

Ingredient ID: NPC51700

Ingredient ID: NPC50676

Ingredient ID: NPC48040

Ingredient ID: NPC47521

Ingredient ID: NPC40078

Ingredient ID: NPC39012

Ingredient ID: NPC310014

Ingredient ID: NPC307335

Ingredient ID: NPC30224

Ingredient ID: NPC301989

Ingredient ID: NPC299501

Ingredient ID: NPC298725

Ingredient ID: NPC297205

Ingredient ID: NPC295380

Ingredient ID: NPC290023

Ingredient ID: NPC278956

Ingredient ID: NPC278620

Ingredient ID: NPC271138

Ingredient ID: NPC270768

Ingredient ID: NPC2701

Ingredient ID: NPC269315

Ingredient ID: NPC266569

Ingredient ID: NPC263935

Ingredient ID: NPC261619

Ingredient ID: NPC259788

Ingredient ID: NPC259733

Ingredient ID: NPC255589

Ingredient ID: NPC25259

Ingredient ID: NPC247139

Ingredient ID: NPC243728

Ingredient ID: NPC239947

Ingredient ID: NPC234664

Ingredient ID: NPC228236

Ingredient ID: NPC227918

Ingredient ID: NPC227318

Ingredient ID: NPC225710

Ingredient ID: NPC220134

Ingredient ID: NPC219876

Ingredient ID: NPC218167

Ingredient ID: NPC216888

Ingredient ID: NPC198842

Ingredient ID: NPC193862

Ingredient ID: NPC193505

Ingredient ID: NPC186948

Ingredient ID: NPC179980

Ingredient ID: NPC178134

Ingredient ID: NPC174177

Ingredient ID: NPC173134

Ingredient ID: NPC167303

Ingredient ID: NPC165179

Ingredient ID: NPC158371

Ingredient ID: NPC152743

Ingredient ID: NPC147013

Ingredient ID: NPC146024

Ingredient ID: NPC142415

Ingredient ID: NPC141225

Ingredient ID: NPC140186

Ingredient ID: NPC132088

Ingredient ID: NPC126958

Ingredient ID: NPC122189

Ingredient ID: NPC117118

Ingredient ID: NPC114710

Ingredient ID: NPC113996

Ingredient ID: NPC109878

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Therapeutic Target	Enzyme	RECQL	ATP-dependent DNA helicase Q1	P46063	CHEMBL1293236
Therapeutic Target	Enzyme	POLB	DNA polymerase beta	P06746	CHEMBL2392
Therapeutic Target	Enzyme	CES1	Acyl coenzyme A:cholesterol acyltransferase	P23141	CHEMBL2265
Therapeutic Target	Enzyme	APEX1	DNA-(apurinic or apyrimidinic site) lyase	P27695	CHEMBL5619
Therapeutic Target	Enzyme	HPGD	15-hydroxyprostaglandin dehydrogenase [NAD+]	P15428	CHEMBL1293255
Therapeutic Target	Lysine demethylase	KDM4E	Lysine-specific demethylase 4D-like	B2RXH2	CHEMBL1293226
Therapeutic Target	Nuclear hormone receptor subfamily 1	NR1H4	Bile acid receptor FXR	Q96RI1	CHEMBL2047
Therapeutic Target	Nuclear hormone receptor subfamily 1	RORC	Nuclear receptor ROR-gamma	P51449	CHEMBL1741186
Therapeutic Target	Other cytosolic protein	HSPA1A	Heat shock 70 kDa protein 1	P0DMV8	CHEMBL5460
Therapeutic Target	Oxidoreductase	HSD11B1	11-beta-hydroxysteroid dehydrogenase 1	P28845	CHEMBL4235
Therapeutic Target	Oxidoreductase	AKR1B10	Aldo-keto reductase family 1 member B10	O60218	CHEMBL5983
Therapeutic Target	Oxidoreductase	AKR1B1	Aldose reductase	P15121	CHEMBL1900
Therapeutic Target	Phosphodiesterase	TDP1	Tyrosyl-DNA phosphodiesterase 1	Q9NUW8	CHEMBL1075138
Therapeutic Target	Protein Kinase	TEK	Tyrosine-protein kinase TIE-2	Q02763	CHEMBL4128
Therapeutic Target	Protein Kinase	MET	Hepatocyte growth factor receptor	P08581	CHEMBL3717
Therapeutic Target	Protein Kinase	NUAK1	NUAK family SNF1-like kinase 1	O60285	CHEMBL5784
Therapeutic Target	Protein Kinase	SRC	Tyrosine-protein kinase SRC	P12931	CHEMBL267
Therapeutic Target	Protein Kinase	KDR	Vascular endothelial growth factor receptor 2	P35968	CHEMBL279
Therapeutic Target	Protein Kinase	EGFR	Epidermal growth factor receptor erbB1	P00533	CHEMBL203
Therapeutic Target	Protein Kinase	INSR	Insulin receptor	P06213	CHEMBL1981
Therapeutic Target	Protein Kinase	CSNK2A1	Casein kinase II alpha	P68400	CHEMBL3629
Therapeutic Target	Protein Kinase	IGF1R	Insulin-like growth factor I receptor	P08069	CHEMBL1957
Therapeutic Target	Protein Phosphatase	CDC25B	Dual specificity phosphatase Cdc25B	P30305	CHEMBL4804
Drug Transporter	SLC superfamily of solute carriers	SLC22A6	Solute carrier family 22 member 6	Q4U2R8	CHEMBL1641347
Drug Transporter	SLC superfamily of solute carriers	SLCO1B3	Solute carrier organic anion transporter family member 1B3	Q9NPD5	CHEMBL1743121
Therapeutic Target	Small molecule receptor (family A GPCR)	GPR35	G-protein coupled receptor 35	Q9HC97	CHEMBL1293267
Therapeutic Target	Structural protein	LMNA	Prelamin-A/C	P02545	CHEMBL1293235
Therapeutic Target	Surface antigen	F3	Coagulation factor III	P13726	CHEMBL4081
Therapeutic Target	Transcription factor	SMAD3	Mothers against decapentaplegic homolog 3	P84022	CHEMBL1293258
Therapeutic Target	Transcription factor	RELA	Nuclear factor NF-kappa-B p65 subunit	Q04206	CHEMBL5533
Therapeutic Target	Transferase	POLH	DNA polymerase eta	Q9Y253	CHEMBL5542
Therapeutic Target	Transferase	FUT7	Alpha-(1,3)-fucosyltransferase 7	Q11130	CHEMBL3596077
Therapeutic Target	Transferase	POLI	DNA polymerase iota	Q9UNA4	CHEMBL5391

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials
NP level	11

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT00455416	Dietary Intervention in Follicular Lymphoma	follicular lymphoma	Ellagic Acid (NPC178134)	NP level
NCT02964377	Plus Epicatechin Duchenne Muscular Dystrophy in Non-ambulatory Adolescents	Duchenne muscular dystrophy	(+)-Epicatechin (NPC261619)	NP level
NCT02330276	Early Phase Pre-Clinical and Initial Clinical Research on Epicatechin	prediabetes syndrome	(+)-Epicatechin (NPC261619)	NP level
NCT04011618	Effect of Ellagic Ácid on the Components of Metabolic Syndrome, Insulin Sensitivity and Insulin Secretion	metabolic syndrome	Ellagic Acid (NPC178134)	NP level
NCT03216876	A Study Of Ursolic Acid For Primary Sclerosing Cholangitis	sclerosing cholangitis	Ursolic Acid (NPC51700)	NP level
NCT02337933	Effect of Ursolic Acid Administration on Insulin Sensitivity and Metabolic Syndrome	metabolic syndrome	Ursolic Acid (NPC51700)	NP level
NCT02656212	Early Phase Pre-Clinical and Initial Clinical Research on Epicatechin (Part 2)	prediabetes syndrome	(+)-Epicatechin (NPC261619)	NP level
NCT04386304	Safety and Biomarker Response to (+)-Epicatechin in Becker Muscular Dystrophy	Becker muscular dystrophy	(+)-Epicatechin (NPC261619)	NP level
NCT01690676	Effect of an Apple Polyphenol Extract on Brachial Artery Flow-mediated Vasodilatory Function	hypertension	(+)-Epicatechin (NPC261619)	NP level
NCT04403568	Testing the Synergism of Phytonutrients, Curcumin and Ursolic Acid, to Target Molecular Pathways in the Prostate	prostate cancer	Ursolic Acid (NPC51700)	NP level
NCT02660112	(+) Epicatechin to Treat Friedreich's Ataxia	Friedreich ataxia	(+)-Epicatechin (NPC261619)	NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Malignant neoplasms of thymus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C27	APEX1,HSD17B10,FUT7,AKR1B1,GALNT2,HPGD,AKR1B10,PTPRC
Breast cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C60-2C6Y	IGF1R,PTPN1,TEK,MET,SRC,EGFR,KDR
Lung cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25	EGFR,RORC,CDC25B,KDR,MET,IGF1R
Hepatoblastoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.01	NUAK1,IGF1R,GPR35,AKR1B1,SRC,AKR1B10
Hepatocellular carcinoma of liver Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.02	AKR1B10,SLC22A6,GPR35,CDC25B,SRC,AKR1B10
Glioblastoma of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.00	LMNA,KDR,POLH,AKR1B10,MET,PTPRC
Stomach cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72	KDR,HSPA1A,HSPA1B,EGFR,MET
Acute diabete complication Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A2Y	PTPN1,HSD11B1,KDR,AKR1B1,INSR
Liver cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12	IGF1R,KDR,CSNK2A1,EGFR,MET
Leishmaniasis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F54	CDC25B,FUT7,AKR1B1,AKR1B10,PTPN1
Other specified malignant neoplasms of kidney, except renal pelvis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90.Y	AKR1B10,MET,FUT7,GPR35,PTPRC
Colorectal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B91	IGF1R,KDR,MET,EGFR
Motor neuron disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B60	HSPA1A,SRC,IGF1R,HSPA1B
Type 2 diabetes mellitus Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A11	HSD11B1,RELA,INSR,PTPN1
Malignant digestive organ neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C11	HSPA1A,SRC,KDR,HSPA1B
Multiple myeloma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A83	IGF1R,KDR,INSR,SRC
Metabolic disorder Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C50-5D2Z	HSD11B1,PTPN1 NCT02337933,NCT04011618
BCR-ABL1-negative chronic myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A41	HSPA1A,HSPA1B,SRC,PTPRC
Alzheimer disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A20	HSD11B1,KDR,INSR,MET
Pancreatic cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10	F3,SRC,IGF1R,EGFR
Brain cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00	EGFR,KDR,MET,SRC
Crohn disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD70	RORC,INSR SLCO1B3,HSD11B1
Pheochromocytoma Disease Category: X.Extension Codes Disease ICD-11 Code: XH3854	FUT7,ELAVL3,MET,RORC
Cytomegaloviral disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D82	KDM4E,GPR35,ELAVL3,HPGD
Chikungunya virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D40	GPR35,EGFR,LMNA,F3
Herpes simplex infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F00	HSPA1B,SMAD3,HSPA1A
Metastatic lymph node neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D60	MET,EGFR,KDR
Renal cell carcinoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90	KDR,MET,EGFR
Pain, unspecified Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG3Z	INSR,AKR1B1,IGF1R
Multiple sclerosis Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A40	RELA,SRC,RORC
Non-small cell lung cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25	KDR,MET,EGFR
Acute myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A60	RELA,SRC,PTPRC
Ovarian cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73	SRC,KDR,MET
Retinopathy Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9B71	APEX1,IGF1R,TEK
Head and neck cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D42	KDR,EGFR,MET
Pleomorphic sarcoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B54	MET,KDR,SRC
Neuropathy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C0Z	HSPA1A,AKR1B1,HSPA1B
Diabetic foot ulcer Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD54	HSPA1B,EGFR,HSPA1A
Chronic arterial occlusive disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD4Z	TEK,MET,CES1
Glaucoma Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9C61	MET,AKR1B1,HSD11B1
Psoriasis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA90	RELA,RORC AKR1B10
Melanoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C30	KDR,EGFR,MET
Cardiovascular disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA00-BE2Z	SRC,MET,KDR
Adenocarcinoma of stomach Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72.0	CDC25B,SLCO1B3,MET
Other specified malignant neoplasms ofcolon Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B90.Y	CDC25B,SLCO1B3,MET
Melanoma of skin Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C30	FUT7,IGF1R,PTPRC
Superficial ovarian endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10.B4	INSR,SRC,LMNA
Malignant neoplasms of oesophagus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B70	HSPA1A,CDC25B,SLCO1B3
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	SLCO1B3,AKR1B10,GPR35
Malignant neoplasms of corpus uteri, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.Z	GPR35,SLCO1B3,AKR1B10
Polycystic ovary syndrome Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A80.1	FUT7,POLH,HPGD
Carpal tunnel syndrome Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C10.0	FUT7,SMAD3,HSD11B1
Malignant neoplasms of adrenal gland Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D11	FUT7,HPGD,MET
Hyper-lipoproteinaemia Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C80	HSD11B1,CES1
Diabetes mellitus, type unspecified Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A14	RELA,INSR
Gastrointestinal stromal tumour Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B5B	KDR,SRC
Rheumatoid arthritis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA20	RELA,AKR1B1
Ischemia Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B10-8B11	SRC,EGFR
Postoperative inflammation Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1A00-CA43	PTPN1,SRC
Myeloproliferative neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A20	SRC,TEK
Nasopharyngeal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B6B	EGFR,CDC25B
Mature T-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A90	PTPRC,EGFR
Malignant haematopoietic neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B33	PTPRC,SRC
Thyroid cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D10	MET,KDR
Chronic pain Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG30	KDR,EGFR
Lupus erythematosus Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A40	RELA,HSD11B1
Metastatic malignant neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D50-2E09	HSPA1B,HSPA1A
Unspecific body region injury Disease Category: 22.Injury, poisoning or certain other consequences of external causes Disease ICD-11 Code: ND56	MET,EGFR
Myelodysplastic syndrome Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A37	EGFR,KDR
Mature B-cell leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A82	EGFR,SRC
Peritoneal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C51	KDR,SRC
Obesity Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5B80-5B81	HSD11B1,PTPN1
Intermediate hyperglycaemia, unspecified Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A40.Z	NCT02330276,NCT02656212
Inflammatory bowel diseases, unspecified Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD7Z	SLCO1B3,HSD11B1
Squamous cell carcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.2	SLCO1B3,AKR1B10
Tetralogy of Fallot Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LA88.2	F3,RORC
Other specified malignant neoplasms of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.Y	SLCO1B3,AKR1B10
Urothelial carcinoma of bladder Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C94.2	SLCO1B3,AKR1B1
Invasive carcinoma of breast Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C61	FUT7,ELAVL3
Human immunodeficiency virus disease without mention of tuberculosis or malaria Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1C62	MET,GPR35
Diffuse large B-cell lymphomas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	APEX1,HSD17B10,AKR1B1,RECQL,CSNK2A1,HSD11B1,F3,PTPN1,NUAK1,SRC,EGFR,LMNA,TDP1,MET,CSNK2A2,KDR,POLH,TEK
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	APEX1,CDC25B,CSNK2A2,FUT7,LMNA,KDR,POLH,SRC,GALNT2,TDP1,RECQL,HPGD,AKR1B10,MET,PTPRC,EGFR
Solid tumour/cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00-2F9Z	HSPA1A,F3,RORC,HSPA1B,SRC,IGF1R,TEK,RELA,POLB,MET,APEX1,EGFR,CSNK2A1,KDR
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	CDC25B,NUAK1,FUT7,LMNA,CES1,TEK,POLB,RECQL,SLCO1B3,AKR1B10,MET,PTPRC,HSD11B1,PTPN1
Serous cystadenoma,borderline malignancy of ovary Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73.4	APEX1,FUT7,MET,POLH,TDP1,SLCO1B3,ELAVL3,HPGD,AKR1B10,CSNK2A1,PTPRC,RORC
Germ cell tumour of testis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80.2	CDC25B,NUAK1,FUT7,KDR,TEK,AKR1B1,SMAD3,HPGD,SLC22A6,MET,PTPRC
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	HSD17B10,FUT7,POLB,AKR1B1,GALNT2,TDP1,ELAVL3,AKR1B10,MET,RORC
Malignant neoplasms of biliary tract, distal bile duct Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C15	NUAK1,IGF1R,GPR35,LMNA,AKR1B1,SRC,ELAVL3,SMAD3,CSNK2A1,F3
Influenza Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1E30-1E32	HSD11B1
Transplant rejection Disease Category: 22.Injury, poisoning or certain other consequences of external causes Disease ICD-11 Code: NE84	PTPRC
Irritable bowel syndrome Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD91	RELA
Atopic eczema Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA80	RELA
Angina pectoris Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA40	EGFR
Fallopian tube cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C74	SRC
Biliary tract cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C17	MET
Metastatic digestive system neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D8Y	SRC
Choreiform disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A01	RELA
Malignant mesenchymal neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B5D-2B5Y	EGFR
Endometrial cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76	SRC
Liver disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB90-DB9Z	MET
Urethral cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C93	EGFR
Diffuse large B-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	PTPRC
NA Disease Category: NA Disease ICD-11 Code: NA	MET
Cataract Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9B10	AKR1B1
Muscular dystrophy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C70	RELA
Thrombosis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB61-GB90	AKR1B1
Intracerebral haemorrhage Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B00	EGFR
Metastatic biliary tract neoplasms Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C14-2C17	EGFR
Epidermal dysplasias Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EK90	SRC
Ischemic heart disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA40-BA6Z	MET
Osteosarcoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B51	SRC
Lysosomal disease Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C56	INSR
Peroxisomal disease Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C57	CES1
Leiomyosarcoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B58	SRC
Fungal infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F29-1F2F	RELA
Inborn lipid metabolism error Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C52	HSD11B1
Mature B-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A85	TEK
Acute respiratory distress syndrome Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CB00	F3
Synovial sarcoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B5A	SRC
Extraocular muscle disorder Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9C82	IGF1R
Myasthenia gravis Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C6Y	HSD11B1
Testicular cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80	EGFR
Skin postprocedural disorder Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EL8Y	EGFR
Type-1/2 diabete Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A10-5A11	INSR
Transplanted organ/tissue Disease Category: 24.Factors influencing health status or contact with health services Disease ICD-11 Code: QB63	PTPRC
Autoimmune disease Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A40-4A45	RORC
Thyrotoxicosis Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A02	IGF1R
Spinal cord/cranial nerve neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A02	EGFR
Digestive organ benign neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2E92	KDR
Synthesis disorder Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C52-5C59	CES1
Chronic kidney disease Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GB61	IGF1R
Thrombocytopenia Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3B64	KDR
Bleeding disorder Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA20-GA21	F3
Psychotic disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A20-6A25	INSR
Ophthalmic devices/implants/grafts injury Disease Category: 23.External causes of morbidity or mortality Disease ICD-11 Code: PK97	PTPN1
Ocular cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D00-2D07	APEX1
Schizophrenia Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A20	AKR1B1
Parkinsonism Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A00	SRC
Colon cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B90	EGFR
Pituitary gland disorder Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A60-5A61	IGF1R
Coronavirus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D92	CSNK2A1
Hypopharyngeal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B6D	EGFR
Acute/subacute hepatic failure Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB91	RELA
Skin and skin-structure infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F28-1G0Z	RELA
Cervical cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C77	SRC
Multiple structural anomalies syndrome Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LD2F	IGF1R
Hepatitis virus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1E50-1E51	EGFR
Indeterminate colitis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD72	RELA
Primary sclerosing cholangitis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB96.2	NCT03216876
Duchenne muscular dystrophy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C70.1	NCT02964377
Becker muscular dystrophy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C70.0	NCT04386304
Friedreich ataxia Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A03.10	NCT02660112
Prostate cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C82	NCT04403568
Follicular lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A80	NCT00455416
Pulmonary hypertension Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BB01	NCT01690676
Zika virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D48	SMAD3
Idiopathic pulmonary fibrosis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CB03.4	SLCO1B3
Malignant neoplasm metastasis in lymph nodes of head, face or neck Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D60.0	SLCO1B3
Myotonic dystrophy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C71.0	HPGD
West Nile virus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D46	MET
Adenocarcinoma of prostate Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C82.0	SLCO1B3
Systemic lupus erythematosus Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A40.0	F3
Malignant neoplasms of thyroid gland, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D10.Z	MET
Renal cell carcinoma, chromophobe type Disease Category: X.Extension Codes Disease ICD-11 Code: XH6153	MET
Ebola virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D60.01	MET
Lyme borreliosis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1C1G	MET
Gliomas of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.0	AKR1B10

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Heliomeris Multiflora

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

76 All known Ingredients in Total

15 Ingredients with Acceptable Bioavailablity

22 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Malignant neoplasms of thymus

Breast cancer

Lung cancer

Hepatoblastoma

Hepatocellular carcinoma of liver

Glioblastoma of brain

Stomach cancer

Acute diabete complication

Liver cancer

Leishmaniasis

Other specified malignant neoplasms of kidney, except renal pelvis

Colorectal cancer

Motor neuron disease

Type 2 diabetes mellitus

Malignant digestive organ neoplasm

Multiple myeloma

Metabolic disorder

BCR-ABL1-negative chronic myeloid leukaemia

Alzheimer disease

Pancreatic cancer

Brain cancer

Crohn disease

Pheochromocytoma

Cytomegaloviral disease

Chikungunya virus disease

Herpes simplex infection

Metastatic lymph node neoplasm

Renal cell carcinoma

Pain, unspecified

Multiple sclerosis

Non-small cell lung cancer

Acute myeloid leukaemia

Ovarian cancer

Retinopathy

Head and neck cancer

Pleomorphic sarcoma

Neuropathy

Diabetic foot ulcer

Chronic arterial occlusive disease

Glaucoma

Psoriasis

Melanoma

Cardiovascular disease

Adenocarcinoma of stomach

Other specified malignant neoplasms ofcolon

Melanoma of skin

Superficial ovarian endometriosis

Malignant neoplasms of oesophagus

Adenocarcinoma of bronchus or lung

Malignant neoplasms of corpus uteri, unspecified

Polycystic ovary syndrome

Carpal tunnel syndrome

Malignant neoplasms of adrenal gland

Hyper-lipoproteinaemia

Diabetes mellitus, type unspecified

Gastrointestinal stromal tumour

Rheumatoid arthritis

Ischemia

Postoperative inflammation

Myeloproliferative neoplasm

Nasopharyngeal cancer

Mature T-cell lymphoma

Malignant haematopoietic neoplasm

Thyroid cancer