• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Tabernaemontana Corymbosa


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

NA

Click for details-----ITS2

ATCGCGTCGCCCTCCCCTCCCCCCTTCCACTCTTCTGTTGGACGGGGGCCGTGCGGGGGAGGGCGGAAAATGGCCTCCCGTGCCAACCCGCGGCCGGCCTAAAAACCCTGGTCCCTCGCCATGGACGTCACGACAAGTGGTGGTTGAAACCCTCAACTCGATTGCGAGTCGTGCGACGACCCGTGGCCGGGAGACCGATCGACCCTATAGCGAGCCGACGCTCGCCACGA
Taxonomic Information

Plant ID: NPO9376
Plant Latin Name: Tabernaemontana Corymbosa
Taxonomy Genus: Tabernaemontana
Taxonomy Family: Apocynaceae

Plant External Links:

NCBI TaxonomyDB: 1679252
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

114 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


41 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

104 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC96778

Ingredient ID: NPC8809

Ingredient ID: NPC81939

Ingredient ID: NPC74025

Ingredient ID: NPC72250

Ingredient ID: NPC62132

Ingredient ID: NPC61142

Ingredient ID: NPC488883

Ingredient ID: NPC488882

Ingredient ID: NPC488881

Ingredient ID: NPC488880

Ingredient ID: NPC488879

Ingredient ID: NPC488878

Ingredient ID: NPC488877

Ingredient ID: NPC488876

Ingredient ID: NPC488875

Ingredient ID: NPC488874

Ingredient ID: NPC488873

Ingredient ID: NPC488872

Ingredient ID: NPC485954

Ingredient ID: NPC485953

Ingredient ID: NPC485952

Ingredient ID: NPC485951

Ingredient ID: NPC485950

Ingredient ID: NPC485949

Ingredient ID: NPC485948

Ingredient ID: NPC485947

Ingredient ID: NPC485946

Ingredient ID: NPC485945

Ingredient ID: NPC485944

Ingredient ID: NPC485943

Ingredient ID: NPC485942

Ingredient ID: NPC485941

Ingredient ID: NPC485940

Ingredient ID: NPC485939

Ingredient ID: NPC485938

Ingredient ID: NPC485937

Ingredient ID: NPC485936

Ingredient ID: NPC485935

Ingredient ID: NPC485934

Ingredient ID: NPC485933

Ingredient ID: NPC485932

Ingredient ID: NPC485931

Ingredient ID: NPC485930

Ingredient ID: NPC485929

Ingredient ID: NPC485928

Ingredient ID: NPC485927

Ingredient ID: NPC485926

Ingredient ID: NPC485924

Ingredient ID: NPC485923

Ingredient ID: NPC485922

Ingredient ID: NPC485921

Ingredient ID: NPC485920

Ingredient ID: NPC485919

Ingredient ID: NPC485918

Ingredient ID: NPC485917

Ingredient ID: NPC485916

Ingredient ID: NPC485915

Ingredient ID: NPC485914

Ingredient ID: NPC485913

Ingredient ID: NPC485912

Ingredient ID: NPC485911

Ingredient ID: NPC485910

Ingredient ID: NPC485909

Ingredient ID: NPC485908

Ingredient ID: NPC485907

Ingredient ID: NPC485906

Ingredient ID: NPC485897

Ingredient ID: NPC485896

Ingredient ID: NPC485895

Ingredient ID: NPC485894

Ingredient ID: NPC485893

Ingredient ID: NPC485892

Ingredient ID: NPC485891

Ingredient ID: NPC485890

Ingredient ID: NPC485889

Ingredient ID: NPC478083

Ingredient ID: NPC478082

Ingredient ID: NPC478081

Ingredient ID: NPC478080

Ingredient ID: NPC478079

Ingredient ID: NPC478078

Ingredient ID: NPC478077

Ingredient ID: NPC478076

Ingredient ID: NPC478075

Ingredient ID: NPC478074

Ingredient ID: NPC476464

Ingredient ID: NPC476069

Ingredient ID: NPC475147

Ingredient ID: NPC475133

Ingredient ID: NPC473041

Ingredient ID: NPC42793

Ingredient ID: NPC329858

Ingredient ID: NPC294231

Ingredient ID: NPC29422

Ingredient ID: NPC291173

Ingredient ID: NPC288350

Ingredient ID: NPC276313

Ingredient ID: NPC269449

Ingredient ID: NPC260909

Ingredient ID: NPC237901

Ingredient ID: NPC208553

Ingredient ID: NPC207884

Ingredient ID: NPC195636

Ingredient ID: NPC19175

Ingredient ID: NPC188604

Ingredient ID: NPC166104

Ingredient ID: NPC144228

Ingredient ID: NPC128476

Ingredient ID: NPC126556

Ingredient ID: NPC119722

Ingredient ID: NPC119459

Ingredient ID: NPC119245

Ingredient ID: NPC111993