• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Weddellina Squamulosa


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAAAACCTGCCCGAGGCAGAACGACCCGCGAACTCGTTTCCGAGCGCGGCGGGGGAGACCGCGGGCCTCCGCGCCCCGGCCCTCCCGCGCCGCAAAGCGCCCGCCGGCGCCCCGCGCGCCGGGCCCGGGCGAACCAAACCCCGGCACAAGACGTGCCAAGGAACACAAAACGAACAGCGAGAGAGGGGCGCTCCGTCCCTCCCCGTCGAAAATAATCGAAACGACTCTTGGCAACGGATATCTTGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCATGATTCGTCACCCCCCCCGCCCTCGGCGCCGGCTCCCCCAGGGGGGCGCGGGCGTGGGACGGGGTTGGGTGGAGGATGGCCTCCCGCGCGCGAGACGCGCGGCTGGCCGAAATACCGGAGCCGCCGGCAGCAGTCTGCCCGGTCGCGGTGGTTGCACGCGACCCTGGCACAAGGCCGGGACAGACGGTGCCGGGACGGGCAAACGAAGGACCCCCCGCGGCGGGCGCGACCCGCCGCAAACCCGA

Click for details-----ITS1

TCGATAACCTGCCTCGGCAGAACCACCCGCGAACGTGTCACGAACCATGCGGCGGGGGAGGAGGGCGCCCGGCGCCGGAACCCCCCGTCGCAGAAAAACGCCCCCGCCGGCGCCCCGTGTGCCGGCTCCGGGCGGAACCAAACCCCGGCACAGGTCGTGCCAAGGAACACGAATCGAAAGAGAGAGGGGGGCACTTTGCCCCTCCCCCACGAGAAAAAATAAAA

Click for details-----ITS2

ATTCGTCACCCCCCCCGCCCTCGGCGCCGGCTCCCCCAGGGGGGCGCGGGCGTGGGACGGGGTTGGGTGGAGGATGGCCTCCCGCGCGCGAGACGCGCGGCTGGCCGAAATACCGGAGCCGCCGGCAGCAGTCTGCCCGGTCGCGGTGGTTGCACGCGACCCTGGCACAAGGCCGGGACAGACGGTGCCGGGACGGGCAAACGAAGGACCCCCCGCGGCGGGCGCGACCCGCCGCAAACCCGA
Taxonomic Information

Plant ID: NPO9320
Plant Latin Name: Weddellina Squamulosa
Taxonomy Genus: Weddellina
Taxonomy Family: Podostemaceae

Plant External Links:

NCBI TaxonomyDB: 116752
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available
Compounds Summary

Overview of Ingredients

138 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


69 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

17 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.





Ingredient Structrual Cards

Ingredient ID: NPC99848

Ingredient ID: NPC94319

Ingredient ID: NPC9338

Ingredient ID: NPC92062

Ingredient ID: NPC90181

Ingredient ID: NPC89966

Ingredient ID: NPC89118

Ingredient ID: NPC85349

Ingredient ID: NPC74670

Ingredient ID: NPC74411

Ingredient ID: NPC73860

Ingredient ID: NPC73700

Ingredient ID: NPC72935

Ingredient ID: NPC7086

Ingredient ID: NPC68899

Ingredient ID: NPC66029

Ingredient ID: NPC65265

Ingredient ID: NPC64527

Ingredient ID: NPC6359

Ingredient ID: NPC61581

Ingredient ID: NPC59833

Ingredient ID: NPC58799

Ingredient ID: NPC58252

Ingredient ID: NPC57105

Ingredient ID: NPC54384

Ingredient ID: NPC54365

Ingredient ID: NPC51695

Ingredient ID: NPC47719

Ingredient ID: NPC44734

Ingredient ID: NPC44397

Ingredient ID: NPC41074

Ingredient ID: NPC31965

Ingredient ID: NPC311540

Ingredient ID: NPC307767

Ingredient ID: NPC302807

Ingredient ID: NPC299614

Ingredient ID: NPC289905

Ingredient ID: NPC28737

Ingredient ID: NPC28633

Ingredient ID: NPC285089

Ingredient ID: NPC283376

Ingredient ID: NPC281411

Ingredient ID: NPC281122

Ingredient ID: NPC280059

Ingredient ID: NPC279122

Ingredient ID: NPC277447

Ingredient ID: NPC271954

Ingredient ID: NPC268595

Ingredient ID: NPC267467

Ingredient ID: NPC267206

Ingredient ID: NPC267162

Ingredient ID: NPC266368

Ingredient ID: NPC265658

Ingredient ID: NPC259399

Ingredient ID: NPC257750

Ingredient ID: NPC257390

Ingredient ID: NPC255315

Ingredient ID: NPC255104

Ingredient ID: NPC255058

Ingredient ID: NPC253703

Ingredient ID: NPC253129

Ingredient ID: NPC24776

Ingredient ID: NPC246929

Ingredient ID: NPC243976

Ingredient ID: NPC242717

Ingredient ID: NPC242275

Ingredient ID: NPC241121

Ingredient ID: NPC238598

Ingredient ID: NPC236795

Ingredient ID: NPC236346

Ingredient ID: NPC233919

Ingredient ID: NPC233147

Ingredient ID: NPC230166

Ingredient ID: NPC226621

Ingredient ID: NPC225258

Ingredient ID: NPC224324

Ingredient ID: NPC223816

Ingredient ID: NPC220501

Ingredient ID: NPC220257

Ingredient ID: NPC217616

Ingredient ID: NPC215609

Ingredient ID: NPC214368

Ingredient ID: NPC21106

Ingredient ID: NPC210312

Ingredient ID: NPC209265

Ingredient ID: NPC209159

Ingredient ID: NPC208201

Ingredient ID: NPC208157

Ingredient ID: NPC208090

Ingredient ID: NPC206051

Ingredient ID: NPC201066

Ingredient ID: NPC200085

Ingredient ID: NPC198855

Ingredient ID: NPC197274

Ingredient ID: NPC192241

Ingredient ID: NPC188906

Ingredient ID: NPC188387

Ingredient ID: NPC188232

Ingredient ID: NPC18123

Ingredient ID: NPC170767

Ingredient ID: NPC169499

Ingredient ID: NPC168103

Ingredient ID: NPC167918

Ingredient ID: NPC166467

Ingredient ID: NPC162080

Ingredient ID: NPC160952

Ingredient ID: NPC159771

Ingredient ID: NPC155990

Ingredient ID: NPC155470

Ingredient ID: NPC154047

Ingredient ID: NPC148304

Ingredient ID: NPC144305

Ingredient ID: NPC143818

Ingredient ID: NPC140931

Ingredient ID: NPC140874

Ingredient ID: NPC139306

Ingredient ID: NPC134102

Ingredient ID: NPC134093

Ingredient ID: NPC133255

Ingredient ID: NPC130821

Ingredient ID: NPC129310

Ingredient ID: NPC129251

Ingredient ID: NPC129

Ingredient ID: NPC128455

Ingredient ID: NPC123980

Ingredient ID: NPC120498

Ingredient ID: NPC117271

Ingredient ID: NPC115659

Ingredient ID: NPC114281

Ingredient ID: NPC113923

Ingredient ID: NPC11267

Ingredient ID: NPC111449

Ingredient ID: NPC109690

Ingredient ID: NPC108847

Ingredient ID: NPC108197

Ingredient ID: NPC106471

Ingredient ID: NPC103557

Ingredient ID: NPC100891

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM
Target Type: Individual Protein of Homo sapiens
*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.
.

Detailed Information of Target Proteins

Target Type Protein Class Gene ID Protein Name Uniprot ID Target ChEMBL ID
Therapeutic Target Cysteine protease CAPN1 Calpain 1 P07384 CHEMBL3891
Therapeutic Target Hydrolase RAB9A Ras-related protein Rab-9A P51151 CHEMBL1293294
Therapeutic Target Hydrolase EIF4A1 Eukaryotic initiation factor 4A-I P60842 CHEMBL2052028
Therapeutic Target Methyl-lysine/arginine binding protein SMN1 Survival motor neuron protein Q16637 CHEMBL1293232
Therapeutic Target Other cytosolic protein HSP90AA1 Heat shock protein HSP 90-alpha P07900 CHEMBL3880
Drug Transporter SLC superfamily of solute carriers SLC2A1 Glucose transporter P11166 CHEMBL2535
Therapeutic Target Transcription factor TP53 Cellular tumor antigen p53 P04637 CHEMBL4096
Therapeutic Target Transcription factor HIF1A Hypoxia-inducible factor 1 alpha Q16665 CHEMBL4261
Therapeutic Target Transporter NPC1 Niemann-Pick C1 protein O15118 CHEMBL1293277
Therapeutic Target Unclassified protein HTT Huntingtin P42858 CHEMBL5514
Therapeutic Target Unclassified protein XBP1 X-box-binding protein 1 P17861 CHEMBL1741176
Clinical Trials Summary
Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type Number of clinical trials
Clinical trial details
NCT ID Title Condition Form in clinical use Associated by plant or compound

❱❱❱ Associated Human Diseases and Detailed Association Evidence

 How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
 ❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant
Association Type & Detailed Evidence
Diffuse large B-cell lymphomas
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A81
 EIF4A1,SMN1,TP53,HTT,EPAS1,LMNA
Mesothelioma of pleura
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C26.0
 EIF4A1,SMN1,NPC1,SLC2A1,CAPN1,LMNA
Germ cell tumour of testis
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C80.2
 SMN1,HSP90AA1,HIF1A,SLC2A1,CAPN1,RAB9A
Malignant neoplasms of biliary tract, distal bile duct
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C15
 TP53,HIF1A,SLC2A1,CAPN1,LMNA
Solid tumour/cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00-2F9Z
 TP53,EPAS1,HIF1A,HSP90AA1
Serous cystadenoma,borderline malignancy of ovary
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C73.4
 SLC2A1,XBP1,TP53,CAPN1
Superficial ovarian endometriosis
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA10.B4
 XBP1,CAPN1,LMNA,RAB9A
Brain cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00
 EPAS1,TP53,HIF1A
Adenocarcinoma of pancreas
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C10.0
 HIF1A,NPC1,LMNA
Glioblastoma of brain
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00.00
 XBP1,LMNA,RAB9A
Ovarian cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C73
 HSP90AA1,TP53
Adrenomedullary hyperfunction
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A75
 HIF1A,EPAS1
Muscular atrophy
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8B61
 SMN1,SMN2
Malignant haematopoietic neoplasm
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B33
 TP53,HSP90AA1
Stomach cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B72
 HSP90AA1,TP53
Mature B-cell leukaemia
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A82
 TP53,HSP90AA1
Carcinosarcoma of uterus
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C76.43
 SLC2A1,TP53
Other specified malignant neoplasms of kidney, except renal pelvis
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C90.Y
 SLC2A1,EIF4A1
Chikungunya virus disease
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D40
 HIF1A,LMNA
Vasomotor/allergic rhinitis
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CA08
 HSP90AA1
Transplant rejection
Disease Category: 22.Injury, poisoning or certain other consequences of external causes
Disease ICD-11 Code: NE84
 TP53
Multiple myeloma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A83
 HSP90AA1
Myelodysplastic syndrome
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A37
 TP53
Kidney failure
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GB60-GB6Z
 TP53
Fungal infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1F29-1F2F
 RAB9A
Asthma
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CA23
 HSP90AA1
Metastatic liver/bile duct neoplasm
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D80
 TP53
Head and neck cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D42
 TP53
Fallopian tube cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C74
 TP53
Cervical cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C77
 TP53
Breast cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C60-2C6Y
 HSP90AA1
Pancreatic cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C10
 TP53
Peritoneal cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C51
 TP53
Ovarian dysfunction
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A80
 TP53
Colorectal cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B91
 TP53
Endometrial cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C76
 TP53
Bladder cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C94
 TP53
Mature B-cell lymphoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A85
 HSP90AA1
Melanoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C30
 HSP90AA1
Chronic arterial occlusive disease
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BD4Z
 TP53
Esophageal cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B70
 TP53
Pulmonary hypertension
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BB01
 HIF1A
Mature T-cell lymphoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A90
 HIF1A
Acute myeloid leukaemia
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A60
 TP53
Acute upper respiratory infection
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CA07
 HSP90AA1
Lung cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25
 HSP90AA1
Encephalopathy
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8E47
 HSP90AA1
Alzheimer disease
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A20
 HSP90AA1
Liposarcoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B59
 TP53
Lip/oral cavity/pharynx neoplasm
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B6E
 TP53
Renal cell carcinoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C90
 EPAS1
Neuropathy
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C0Z
 HSP90AA1
Pheochromocytoma
Disease Category: X.Extension Codes
Disease ICD-11 Code: XH3854
 EPAS1
Hepatoblastoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C12.01
 SLC2A1
Malignant neoplasm metastasis in lymph nodes of head, face or neck
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D60.0
 SLC2A1
Myotonic dystrophy
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C71.0
 SLC2A1
Squamous cell carcinoma of bronchus or lung
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25.2
 SLC2A1
West Nile virus infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D46
 XBP1
Other specified malignant neoplasms ofcolon
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B90.Y
 SLC2A1
Other specified malignant neoplasms of bronchus or lung
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25.Y
 SLC2A1
Malignant neoplasms of oesophagus
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B70
 SLC2A1
Systemic lupus erythematosus
Disease Category: 04.Diseases of the immune system
Disease ICD-11 Code: 4A40.0
 EPAS1
Adenocarcinoma of bronchus or lung
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25.0
 SLC2A1
Malignant neoplasms of corpus uteri, unspecified
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C76.Z
 SLC2A1
Malignant neoplasms of thymus
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C27
 EIF4A1
Invasive carcinoma of breast
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C61
 SLC2A1
Renal cell carcinoma, chromophobe type
Disease Category: X.Extension Codes
Disease ICD-11 Code: XH6153
 NPC1
Malignant neoplasms of adrenal gland
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D11
 SLC2A1

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network 
Data Section
Select to Download
1. General Info & Plant Usage & Geographical Distribution  
2. Plant Ingredients  
3. Collective Molecular Proteins  
4. Collective Enriched Activities  
5. Plant molecular targets overlapping with DEGs  
6. Associated clinical trials  
7. Associated Human Diseases  
>> Targets derived from weak experimental activities
About Us

The CMAUP database is developed by the Bioinformatics & Drug Design group (BIDD) and School of Pharmacy, Fudan University.

CMAUP

Home

About

Browse

Help

Useful links

BIDD home

NPASS database

TCM-ID database

TTD database

Contact

826 Zhangheng Road, Pudong New District, Shanghai, China

Principle Investigator:
Prof. Chen Yu Zong
chenyuzong@sz.tsinghua.edu.cn
Prof. Zeng Xian
zengxian@fudan.edu.cn

Developer & Maintainer:
Ph.D. Student Dongyue Hou
dyhou22@m.fudan.edu.cn
Mr. Hanbo Lin
hblin19@fudan.edu.cn
Ms. Yuhan Feng
yhfeng22@m.fudan.edu.cn

© 2023 Copyright: Bioinformatics & Drug Design group