CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Plantago Cornuti

Example Image

PLANiTS DNA barcode

Click for details-----ITS

AGCAATCCATTNTTCGGNACATCGTGCCTGCCCGGTGCTTGCACTTGGTGGGCTAACGAACCCGGCGCGGCAAGCGCCAAGGAAAACAAAATGGAAGCGTTGCTCCCCGTGACTCCCGTTCGCGGTGTGGTTTTGGGGATGTGATGTATCTTGAAAGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGACGCTTCGGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCTACACCAATTTGGTGCGGGGGCGGATAATGGCATCCCGTTAGCTCGGTTTGCCCAAAAAGGATCCCTCATTGACGGATGTCACAACCAGTGGTGGTTGAAAGATCATTGGTGCCGTTGTGCTTCACTCCGTCGCATGCTTGGGCATCGTTACAAAACAATGGTGCTAACGCGCCTTCGA

Click for details-----ITS1

AGCAATCCATTNTTCGGNACATCGTGCCTGCCCGGTGCTTGCACTTGGTGGGCTAACGAACCCGGCGCGGCAAGCGCCAAGGAAAACAAAATGGAAGCGTTGCTCCCCGTGACTCCCGTTCGCGGTGTGGTTTTGGGGATGTGATGTATCTTGAAAGTCAAAA

Click for details-----ITS2

Taxonomic Information

Plant ID: NPO9258
Plant Latin Name: Plantago Cornuti
Taxonomy Genus: Plantago
Taxonomy Family: Plantaginaceae

Plant External Links:

NCBI TaxonomyDB: 197799
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:

China

Traditional Medicine System:

TCM

Geographical Distribution

China

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

46 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

33 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

17 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC96359

Ingredient ID: NPC94116

Ingredient ID: NPC88459

Ingredient ID: NPC84319

Ingredient ID: NPC71074

Ingredient ID: NPC64464

Ingredient ID: NPC61543

Ingredient ID: NPC51700

Ingredient ID: NPC50898

Ingredient ID: NPC48673

Ingredient ID: NPC47781

Ingredient ID: NPC46625

Ingredient ID: NPC41160

Ingredient ID: NPC40135

Ingredient ID: NPC33351

Ingredient ID: NPC311439

Ingredient ID: NPC306128

Ingredient ID: NPC299985

Ingredient ID: NPC299696

Ingredient ID: NPC296551

Ingredient ID: NPC290216

Ingredient ID: NPC278355

Ingredient ID: NPC275276

Ingredient ID: NPC270768

Ingredient ID: NPC263548

Ingredient ID: NPC249069

Ingredient ID: NPC241154

Ingredient ID: NPC230301

Ingredient ID: NPC222140

Ingredient ID: NPC221072

Ingredient ID: NPC183950

Ingredient ID: NPC18074

Ingredient ID: NPC178396

Ingredient ID: NPC17687

Ingredient ID: NPC175636

Ingredient ID: NPC170826

Ingredient ID: NPC169012

Ingredient ID: NPC145379

Ingredient ID: NPC142415

Ingredient ID: NPC1418

Ingredient ID: NPC137062

Ingredient ID: NPC136786

Ingredient ID: NPC129430

Ingredient ID: NPC123555

Ingredient ID: NPC120163

Ingredient ID: NPC105933

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Cytochrome P450	Cytochrome P450 family 1	CYP1B1	Cytochrome P450 1B1	Q16678	CHEMBL4878
Cytochrome P450	Cytochrome P450 family 1	CYP1A1	Cytochrome P450 1A1	P04798	CHEMBL2231
Cytochrome P450	Cytochrome P450 family 1	CYP1A2	Cytochrome P450 1A2	P05177	CHEMBL3356
Therapeutic Target	Enzyme	RECQL	ATP-dependent DNA helicase Q1	P46063	CHEMBL1293236
Therapeutic Target	Enzyme	CES1	Acyl coenzyme A:cholesterol acyltransferase	P23141	CHEMBL2265
Therapeutic Target	Hydrolase	ACHE	Acetylcholinesterase	P22303	CHEMBL220
Therapeutic Target	Nuclear hormone receptor subfamily 1	NR1H4	Bile acid receptor FXR	Q96RI1	CHEMBL2047
Therapeutic Target	Nuclear hormone receptor subfamily 1	RORC	Nuclear receptor ROR-gamma	P51449	CHEMBL1741186
Therapeutic Target	Nuclear hormone receptor subfamily 3	ESR2	Estrogen receptor beta	Q92731	CHEMBL242
Therapeutic Target	Oxidoreductase	HSD11B1	11-beta-hydroxysteroid dehydrogenase 1	P28845	CHEMBL4235
Therapeutic Target	Oxidoreductase	HSD17B1	Estradiol 17-beta-dehydrogenase 1	P14061	CHEMBL3181
Therapeutic Target	Oxidoreductase	AKR1B10	Aldo-keto reductase family 1 member B10	O60218	CHEMBL5983
Therapeutic Target	Protein Kinase	CSNK2A1	Casein kinase II alpha	P68400	CHEMBL3629
Therapeutic Target	Protein Kinase	MKNK2	MAP kinase signal-integrating kinase 2	Q9HBH9	CHEMBL4204
Therapeutic Target	Protein Phosphatase	CDC25B	Dual specificity phosphatase Cdc25B	P30305	CHEMBL4804
Therapeutic Target	Secreted protein	TTR	Transthyretin	P02766	CHEMBL3194
Therapeutic Target	Secreted protein	THPO	Thrombopoietin	P40225	CHEMBL1293256
Therapeutic Target	Serine protease	DPP4	Dipeptidyl peptidase IV	P27487	CHEMBL284
Drug Transporter	SLC superfamily of solute carriers	SLCO1B3	Solute carrier organic anion transporter family member 1B3	Q9NPD5	CHEMBL1743121
Therapeutic Target	Surface antigen	F3	Coagulation factor III	P13726	CHEMBL4081
Therapeutic Target	Transcription factor	RELA	Nuclear factor NF-kappa-B p65 subunit	Q04206	CHEMBL5533

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials
NP level	3

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT04403568	Testing the Synergism of Phytonutrients, Curcumin and Ursolic Acid, to Target Molecular Pathways in the Prostate	prostate cancer	Ursolic Acid (NPC51700)	NP level
NCT03216876	A Study Of Ursolic Acid For Primary Sclerosing Cholangitis	sclerosing cholangitis	Ursolic Acid (NPC51700)	NP level
NCT02337933	Effect of Ursolic Acid Administration on Insulin Sensitivity and Metabolic Syndrome	metabolic syndrome	Ursolic Acid (NPC51700)	NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Serous cystadenoma,borderline malignancy of ovary Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73.4	PSMB5,CSNK2A3,CYP1A2,AKR1B10,XDH,SLCO1B3,CSNK2A1,RORC,PTPRC
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	CDC25B,PTPRC,AKR1B10,XDH,CSNK2A2,RECQL,DPP4
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	ACHE,F2,AKR1B10,TTR,THPO,XDH,SLCO1B3
Germ cell tumour of testis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80.2	ACHE,CDC25B,F2,XDH,TTR,PTPRC,DPP4
Solid tumour/cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00-2F9Z	F3,XDH,RELA,RORC,CSNK2A1,MKNK2
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	PSMB5,CYP19A1,AKR1B10,XDH,RORC,DPP4
Other specified malignant neoplasms of kidney, except renal pelvis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90.Y	ACHE,CYP19A1,AKR1B10,XDH,PTPRC,F2
Malignant neoplasms of thymus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C27	ACHE,PSMB5,CYP1B1,AKR1B10,PTPRC,DPP4
Glioblastoma of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.00	CSNK2A3,CYP1B1,CYP19A1,AKR1B10,PTPRC,DPP4
Type 2 diabetes mellitus Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A11	F2,RELA,PTPN1,DPP4,HSD11B1
Squamous cell carcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.2	HSD17B1,F2,AKR1B10,XDH,SLCO1B3
Hepatocellular carcinoma of liver Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.02	AKR1B10,CYP19A1,CDC25B,AKR1B10,CYP19A1
Malignant neoplasms of corpus uteri, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.Z	CYP1A1,F2,AKR1B10,XDH,SLCO1B3
Psoriasis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA90	RELA,RORC,DPP4 AKR1B10
Metabolic disorder Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C50-5D2Z	HSD11B1,DPP4,PTPN1 NCT02337933
Breast cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C60-2C6Y	PTPN1,CYP19A1,MKNK2,ESR2
Pheochromocytoma Disease Category: X.Extension Codes Disease ICD-11 Code: XH3854	ACHE,TTR,XDH,RORC
Malignant neoplasms of biliary tract, distal bile duct Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C15	F3,CSNK2A3,CSNK2A1,ESR2
Leishmaniasis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F54	CDC25B,PTPN1,AKR1B10,DPP4
Adenocarcinoma of stomach Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72.0	CDC25B,F2,CYP19A1,SLCO1B3
Other specified malignant neoplasms ofcolon Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B90.Y	CDC25B,CYP1A1,F2,SLCO1B3
Other specified malignant neoplasms of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.Y	HSD17B1,AKR1B10,XDH,SLCO1B3
Urothelial carcinoma of bladder Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C94.2	SLCO1B3,HSD17B1,TTR,CYP1A2
Cytomegaloviral disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D82	ACHE,CYP1A1,THPO,ESR2
Carpal tunnel syndrome Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C10.0	CYP1B1,THPO,HSD11B1,DPP4
Myocardial infarction Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA41-BA43	DPP4,THPO,F2
Acute diabete complication Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A2Y	DPP4,PTPN1,HSD11B1
Alzheimer disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A20	ESR2,ACHE,HSD11B1
Hyper-lipoproteinaemia Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C80	CES1,HSD11B1,ESR2
Multiple sclerosis Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A40	RELA,F2,RORC
Crohn disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD70	RORC SLCO1B3,HSD11B1
West Nile virus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D46	ACHE,DPP4,CYP19A1
Tetralogy of Fallot Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LA88.2	F3,F2,RORC
Superficial ovarian endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10.B4	ACHE,HSD17B1,DPP4
Malignant neoplasms of oesophagus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B70	ACHE,CDC25B,SLCO1B3
Systemic lupus erythematosus Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A40.0	ACHE,CYP1A1,F3
Malignant neoplasms of thyroid gland, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D10.Z	CYP1B1,XDH,DPP4
Chikungunya virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D40	F3,XDH,CYP19A1
Renal cell carcinoma, chromophobe type Disease Category: X.Extension Codes Disease ICD-11 Code: XH6153	CYP1A1,CYP1A2,TTR
Malignant haematopoietic neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B33	PTPRC,DPP4
Mature T-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A90	PTPRC,MKNK2
Myasthenia gravis Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C6Y	HSD11B1,ACHE
Liver cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12	MKNK2,CSNK2A1
Cushing syndrome Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A70	ESR2,CYP19A1
Acute myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A60	PTPRC,RELA
Lupus erythematosus Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A40	RELA,HSD11B1
Chronic arterial occlusive disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD4Z	DPP4,CES1
Lung cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25	RORC,CDC25B
Ischaemic/haemorrhagic stroke Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B20	THPO,F2
Influenza Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1E30-1E32	HSD11B1,XDH
Indeterminate colitis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD72	ESR2,RELA
Glaucoma Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9C61	ACHE,HSD11B1
Diabetes mellitus, type unspecified Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A14	RELA,DPP4
Bleeding disorder Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA20-GA21	F3,F2
Obesity Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5B80-5B81	PTPN1,HSD11B1
Prostate cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C82	ESR2 NCT04403568
Inflammatory bowel diseases, unspecified Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD7Z	SLCO1B3,HSD11B1
Hepatoblastoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.01	CYP19A1,AKR1B10
Malignant neoplasm metastasis in lymph nodes of head, face or neck Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D60.0	F2,SLCO1B3
Melanoma of skin Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C30	TTR,PTPRC
Adenocarcinoma of prostate Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C82.0	TTR,SLCO1B3
Malignant neoplasms of adrenal gland Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D11	DPP4,CYP19A1
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	ACHE,CDC25B,CES1,PTPRC,PTPN1,CYP1B1,F2,AKR1B10,TTR,XDH,HSD11B1,SLCO1B3,RECQL,DPP4
Diffuse large B-cell lymphomas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	ACHE,PSMB5,PTPN1,F3,CSNK2A1,THPO,HSD11B1,CSNK2A2,RECQL,ESR2
Mineral deficiency Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5B5K	XDH
Cardiovascular disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA00-BE2Z	F2
Atopic eczema Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA80	RELA
Coagulation defect Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3B10	F2
Coronary thrombosis Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA43	F2
Prostate hyperplasia Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA90	ESR2
Parasitic worm infestation Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F90	ACHE
Amyloidosis Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5D00	TTR
Cerebral ischaemic stroke Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B11	F2
Inborn lipid metabolism error Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C52	HSD11B1
Nutritional deficiency Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5B50-5B71	F2
Substance abuse Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6C40	ACHE
Thrombosis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB61-GB90	F2
Ophthalmic devices/implants/grafts injury Disease Category: 23.External causes of morbidity or mortality Disease ICD-11 Code: PK97	PTPN1
Peroxisomal disease Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C57	CES1
Oesophageal/gastroduodenal disorder Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD90	ACHE
Rheumatoid arthritis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA20	RELA
Heart failure Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD10-BD1Z	XDH
Unspecific substance harmful effect Disease Category: 22.Injury, poisoning or certain other consequences of external causes Disease ICD-11 Code: NE6Z	ACHE
Mild neurocognitive disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6D71	ACHE
Dementia Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6D80-6D8Z	ACHE
Autism spectrum disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A02	DPP4
Neuropathy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C0Z	CYP19A1
Skin and skin-structure infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F28-1G0Z	RELA
Fungal infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F29-1F2F	RELA
Synthesis disorder Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C52-5C59	CES1
Colorectal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B91	MKNK2
Irritable bowel syndrome Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD91	RELA
Encephalopathy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8E47	XDH
Pediculosis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1G00	ACHE
Pain, unspecified Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG3Z	ACHE
Choreiform disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A01	RELA
Menopausal disorder Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA30	ESR2
Vasomotor/allergic rhinitis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA08	ESR2
Gout Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA25	XDH
Acute/subacute hepatic failure Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB91	RELA
Cardiomyopathy Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BC43	TTR
Transplanted organ/tissue Disease Category: 24.Factors influencing health status or contact with health services Disease ICD-11 Code: QB63	PTPRC
Thrombocytopenia Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3B64	F2
Asthma Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA23	F2
Chronic kidney disease Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GB61	XDH
Transplant rejection Disease Category: 22.Injury, poisoning or certain other consequences of external causes Disease ICD-11 Code: NE84	PTPRC
Parkinsonism Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A00	ACHE
Sepsis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1G40-1G41	ESR2
Inborn purine/pyrimidine/nucleotide metabolism error Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C55	XDH
Nasopharyngeal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B6B	CDC25B
Acute respiratory distress syndrome Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CB00	F3
Oesophagitis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA24	CYP19A1
Postoperative inflammation Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1A00-CA43	PTPN1
Hepatitis virus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1E50-1E51	ESR2
Diffuse large B-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	PTPRC
Coronavirus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D92	CSNK2A1
Angina pectoris Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA40	F2
BCR-ABL1-negative chronic myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A41	PTPRC
Muscular dystrophy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C70	RELA
Pancreatic cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10	F3
Endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10	CYP19A1
Autoimmune disease Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A40-4A45	RORC
Primary sclerosing cholangitis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB96.2	NCT03216876
Coeliac disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA95	CYP1A1
Zika virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D48	ACHE
Idiopathic pulmonary fibrosis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CB03.4	SLCO1B3
Myotonic dystrophy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C71.0	CYP1A1
Pneumonia due to Pseudomonasaeruginosa Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA40.05	DPP4
Chronic rhinosinusitis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA0A	CYP1A1
Invasive carcinoma of breast Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C61	THPO
Heart failure, unspecified Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD1Z	CYP1B1
Ebola virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D60.01	ACHE
Gliomas of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.0	AKR1B10

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Plantago Cornuti

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

Country/Region:

Traditional Medicine System:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

46 All known Ingredients in Total

33 Ingredients with Acceptable Bioavailablity

17 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Serous cystadenoma,borderline malignancy of ovary

Mesothelioma of pleura

Adenocarcinoma of bronchus or lung

Germ cell tumour of testis

Solid tumour/cancer

Carcinosarcoma of uterus

Other specified malignant neoplasms of kidney, except renal pelvis

Malignant neoplasms of thymus

Glioblastoma of brain

Type 2 diabetes mellitus

Squamous cell carcinoma of bronchus or lung

Hepatocellular carcinoma of liver

Malignant neoplasms of corpus uteri, unspecified

Psoriasis

Metabolic disorder

Breast cancer

Pheochromocytoma

Malignant neoplasms of biliary tract, distal bile duct

Leishmaniasis

Adenocarcinoma of stomach

Other specified malignant neoplasms ofcolon

Other specified malignant neoplasms of bronchus or lung

Urothelial carcinoma of bladder

Cytomegaloviral disease

Carpal tunnel syndrome

Myocardial infarction

Acute diabete complication

Alzheimer disease

Hyper-lipoproteinaemia

Multiple sclerosis

Crohn disease

West Nile virus infection

Tetralogy of Fallot

Superficial ovarian endometriosis

Malignant neoplasms of oesophagus

Systemic lupus erythematosus

Malignant neoplasms of thyroid gland, unspecified

Chikungunya virus disease

Renal cell carcinoma, chromophobe type

Malignant haematopoietic neoplasm

Mature T-cell lymphoma

Myasthenia gravis

Liver cancer

Cushing syndrome

Acute myeloid leukaemia

Lupus erythematosus

Chronic arterial occlusive disease

Lung cancer

Ischaemic/haemorrhagic stroke

Influenza

Indeterminate colitis

Glaucoma

Diabetes mellitus, type unspecified

Bleeding disorder

Obesity

Prostate cancer

Inflammatory bowel diseases, unspecified

Hepatoblastoma

Malignant neoplasm metastasis in lymph nodes of head, face or neck

Melanoma of skin

Adenocarcinoma of prostate

Malignant neoplasms of adrenal gland