• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Plantago Cornuti


Example Image
PLANiTS DNA barcode

Click for details-----ITS

AGCAATCCATTNTTCGGNACATCGTGCCTGCCCGGTGCTTGCACTTGGTGGGCTAACGAACCCGGCGCGGCAAGCGCCAAGGAAAACAAAATGGAAGCGTTGCTCCCCGTGACTCCCGTTCGCGGTGTGGTTTTGGGGATGTGATGTATCTTGAAAGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGACGCTTCGGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCTACACCAATTTGGTGCGGGGGCGGATAATGGCATCCCGTTAGCTCGGTTTGCCCAAAAAGGATCCCTCATTGACGGATGTCACAACCAGTGGTGGTTGAAAGATCATTGGTGCCGTTGTGCTTCACTCCGTCGCATGCTTGGGCATCGTTACAAAACAATGGTGCTAACGCGCCTTCGA

Click for details-----ITS1

AGCAATCCATTNTTCGGNACATCGTGCCTGCCCGGTGCTTGCACTTGGTGGGCTAACGAACCCGGCGCGGCAAGCGCCAAGGAAAACAAAATGGAAGCGTTGCTCCCCGTGACTCCCGTTCGCGGTGTGGTTTTGGGGATGTGATGTATCTTGAAAGTCAAAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO9258
Plant Latin Name: Plantago Cornuti
Taxonomy Genus: Plantago
Taxonomy Family: Plantaginaceae

Plant External Links:

NCBI TaxonomyDB: 197799
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
China

Traditional Medicine System:
TCM

Geographical Distribution

China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

46 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


33 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

17 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC96359

Ingredient ID: NPC94116

Ingredient ID: NPC88459

Ingredient ID: NPC84319

Ingredient ID: NPC71074

Ingredient ID: NPC64464

Ingredient ID: NPC61543

Ingredient ID: NPC51700

Ingredient ID: NPC50898

Ingredient ID: NPC48673

Ingredient ID: NPC47781

Ingredient ID: NPC46625

Ingredient ID: NPC41160

Ingredient ID: NPC40135

Ingredient ID: NPC33351

Ingredient ID: NPC311439

Ingredient ID: NPC306128

Ingredient ID: NPC299985

Ingredient ID: NPC299696

Ingredient ID: NPC296551

Ingredient ID: NPC290216

Ingredient ID: NPC278355

Ingredient ID: NPC275276

Ingredient ID: NPC270768

Ingredient ID: NPC263548

Ingredient ID: NPC249069

Ingredient ID: NPC241154

Ingredient ID: NPC230301

Ingredient ID: NPC222140

Ingredient ID: NPC221072

Ingredient ID: NPC183950

Ingredient ID: NPC18074

Ingredient ID: NPC178396

Ingredient ID: NPC17687

Ingredient ID: NPC175636

Ingredient ID: NPC170826

Ingredient ID: NPC169012

Ingredient ID: NPC145379

Ingredient ID: NPC142415

Ingredient ID: NPC1418

Ingredient ID: NPC137062

Ingredient ID: NPC136786

Ingredient ID: NPC129430

Ingredient ID: NPC123555

Ingredient ID: NPC120163

Ingredient ID: NPC105933