CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Catunaregam Spinosa

Example Image

PLANiTS DNA barcode

Click for details-----ITS

GATCATTGTCGATGTCCCGAAACGAACGACCGCGAACCCGTTTTATACACGGCCGCGCCGCGGGGATGGCGGCGGGCGCGCGGGAGGCCCAGTGCTCCCCGCCCGTCGTCGTCCCCCGGCGCGCGCCCACCCGCCCGCTCGGGCGCGCGAGCGCTCGGACGGGCGAAGCTCACAAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTCGAAACGATCGCCCGGCCCCCCGACCGCCCCGTCCGCGGCGCGCGGCGCGGGGGCGTCGCGGCATCCGTCGTAACCGAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCTCGTCGCCGCAAACCCCCGTCTCGCGGGGCGTTCGGCGGAGATTGGCCTCCCGTGCCCCGTCTCGCGGGCGCGGCCGGCCTAAATTCGAGTCCTCGGCGAGGGCGTCGCGACCGGTGGTGGTTGAATTTTCTCGACTCGAGTCGTCGTCGCGCCGTTTTCCCCCCGCCGTCTCCCGGACTCGCCCGACCCCGAAGAAGAGGCGCGCGAGCCTCGA

Click for details-----ITS1

Click for details-----ITS2

Taxonomic Information

Plant ID: NPO9164
Plant Latin Name: Catunaregam Spinosa
Taxonomy Genus: Catunaregam
Taxonomy Family: Rubiaceae

Plant External Links:

NCBI TaxonomyDB: 136894
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:

South Africa; Tanzania; India; Rwanda; Kenya; Philippines

Traditional Medicine System:

Sowa-Rigpa; Indian Folk; Unani; Ayurveda; Siddha

Geographical Distribution

South Africa; Philippines; India; Rwanda; Kenya; Tanzania

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

45 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

19 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)