• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Atriplex Parvifolia


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAAACCTGCCCAGCAGAGCGACCAGAGAACGTGTTTATCATGAACGGGGTTTGGGCGAAAGCCCCTTCCTCAAGCTGGGGAATCGCTATGCCTCGGCGGTGCGTCCTCCCCGGCACAATAACGAACCCCGGCGCGGTCTGCGCCAAGGAACATGAATACAAGTGTGCCCTTCCGCAACAGGTTCGCCTGTTGTGGACGTGGCACCAAGTCGTATATAACATTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCTGAAGCCTTTAGGTCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCTCCCCCCACCACCCAGTGTGGATGGGGAGGAGGATGATGGCTTCCCATGCCTCACCGGGCGTGGATGGCCTAAATAAGGAGCCCCCGGTTACGAAGTGCCGCGGCGATTGGTGGAATACAAGGCCTAGCCTAGGATGAAACGGTAATCGCGCACATTGTAGCTCTTGAGGACTCGCAGGACCCTTACTTGTTTGCCCTTAGGGGCGGCAAAACCGTT

Click for details-----ITS1

NA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO9144
Plant Latin Name: Atriplex Parvifolia
Taxonomy Genus: Atriplex
Taxonomy Family: Chenopodiaceae

Plant External Links:

NCBI TaxonomyDB: 880681
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

65 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


56 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

25 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC97072

Ingredient ID: NPC95224

Ingredient ID: NPC93658

Ingredient ID: NPC91344

Ingredient ID: NPC84585

Ingredient ID: NPC78359

Ingredient ID: NPC72170

Ingredient ID: NPC68935

Ingredient ID: NPC65428

Ingredient ID: NPC6362

Ingredient ID: NPC38262

Ingredient ID: NPC36965

Ingredient ID: NPC34518

Ingredient ID: NPC30190

Ingredient ID: NPC29883

Ingredient ID: NPC294902

Ingredient ID: NPC293871

Ingredient ID: NPC290181

Ingredient ID: NPC28624

Ingredient ID: NPC286190

Ingredient ID: NPC285362

Ingredient ID: NPC284585

Ingredient ID: NPC282549

Ingredient ID: NPC27633

Ingredient ID: NPC26713

Ingredient ID: NPC25499

Ingredient ID: NPC253675

Ingredient ID: NPC251127

Ingredient ID: NPC24101

Ingredient ID: NPC235209

Ingredient ID: NPC232720

Ingredient ID: NPC232529

Ingredient ID: NPC232114

Ingredient ID: NPC230098

Ingredient ID: NPC223125

Ingredient ID: NPC223124

Ingredient ID: NPC222506

Ingredient ID: NPC218614

Ingredient ID: NPC218029

Ingredient ID: NPC212949

Ingredient ID: NPC210138

Ingredient ID: NPC201092

Ingredient ID: NPC195181

Ingredient ID: NPC180450

Ingredient ID: NPC175292

Ingredient ID: NPC166589

Ingredient ID: NPC158148

Ingredient ID: NPC157104

Ingredient ID: NPC155735

Ingredient ID: NPC14921

Ingredient ID: NPC147091

Ingredient ID: NPC146785

Ingredient ID: NPC145019

Ingredient ID: NPC132158

Ingredient ID: NPC124433

Ingredient ID: NPC122610

Ingredient ID: NPC122009

Ingredient ID: NPC115556

Ingredient ID: NPC111587

Ingredient ID: NPC106692

Ingredient ID: NPC104755

Ingredient ID: NPC103459

Ingredient ID: NPC102305

Ingredient ID: NPC100151

Ingredient ID: NPC100099