• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Haemanthus Amarylloides


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGATGCCTGAACGGACGACCGTGAACTTGTAGAGCACCTGTGGGGAGGGGAAGAAGGTGGTGATCTCCAGTCTCCTTTGCCTCCTTAAGTGCCCCAGCCGCTGCCGTCCTGCATAATGTGCAGGACGAGCGGCGAGAACAATTTCCGGCGCGGTGTGCGCCAAGGAATAGACCCATTTGGAGAGTGGAGCTTGCTGCACGCCTAGTGATGCTGTAGGCGACGTGATCCTGGTACGTTTAACTTGTACGACTCTCGGCAACGGATATCTTGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACCTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCTATCTGGTCGAGGGCACGCCTGCCTGGGCGTCACGCCTACTGGCGCTCAGTGCCTCTTGCACCATCACCTTATGTTGTTGGTGAGAGGCACGGATGCGGAGATTGGCCTCCCGCGCATCGCTGCGTGGTGGGTCGAAGTGCGGGCCGTTGTCTGGGCCAGACGTGGCGAGTGGTGGATTGACACGCACGCTGTCGTTGAGCGACCCTAGCCCGGGCGGTGCACCGGAGGAACCCACGCCGACAGGCGCCACCTGAGCGTCCCTTGGA

Click for details-----ITS1

NA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO9125
Plant Latin Name: Haemanthus Amarylloides
Taxonomy Genus: Haemanthus
Taxonomy Family: Amaryllidaceae

Plant External Links:

NCBI TaxonomyDB: 886269
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

11 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


10 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

9 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC50315

Ingredient ID: NPC39064

Ingredient ID: NPC260000

Ingredient ID: NPC230479

Ingredient ID: NPC209560

Ingredient ID: NPC202431

Ingredient ID: NPC156751

Ingredient ID: NPC156654

Ingredient ID: NPC15658

Ingredient ID: NPC125449

Ingredient ID: NPC121522