• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Inula Japonica


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAAGCCTATAAGCGAACGACCCGTGAACGTGTAACAACATCAGAGCATCATAGGTCTCGGGCTTTTGCTCGTGACGTATGGCGCCTCGTCGATTTGCATCCATGGTCGCCTCTTCGGAGCCTCCATGATGTCAGAAAGGCGTTAACCAACCCCGGCACGGCATGTGCCAAGGAAGAATAAACTTTAAGACGGCCTCGTTCATGTCGCCCCGTTCGCGGTGTGTGCATGTGACGCGGCTTCTTTGTAAACCATAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCACTCGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCTCCTCACCGTGCCTCCATAAAGGGGTGTGCGAGGTAGGAGCGGATACTGGTCTCCCGTGCCAACGGTGCGGTTGGCCAAAATAGGAGTCTCCTTTGATGGATACACGGCAAGTGGTGGTTGACAAAACCTTAGTCTCGTGTCGTGTGTCCTTACTTGTAAGCGAAGACCTCGTAAAGTACCCTAACGCGCCGTGTTATGACGGCGCATCGACCGCGACCCCAGGTCAGGCGGGAT

Click for details-----ITS1

NA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO9124
Plant Latin Name: Inula Japonica
Taxonomy Genus: Inula
Taxonomy Family: Asteraceae

Plant External Links:

NCBI TaxonomyDB: 453958
Plant-of-the-World-Online: 927450-1

Used in Medicines

Country/Region:
China

Traditional Medicine System:
TCM

Geographical Distribution

Turkey; Afghanistan; Saudi Arabia; Yemen; Iran; Turkmenistan; South Africa; Kuwait; Uzbekistan; Mongolia; United States; Tajikistan; China; Oman; Japan; Taiwan; Iraq; Kazakhstan; Russia

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

109 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


82 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

59 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC9851

Ingredient ID: NPC93376

Ingredient ID: NPC92489

Ingredient ID: NPC84868

Ingredient ID: NPC84425

Ingredient ID: NPC8406

Ingredient ID: NPC81010

Ingredient ID: NPC80427

Ingredient ID: NPC71536

Ingredient ID: NPC61506

Ingredient ID: NPC56593

Ingredient ID: NPC54773

Ingredient ID: NPC49341

Ingredient ID: NPC483169

Ingredient ID: NPC483168

Ingredient ID: NPC483167

Ingredient ID: NPC483166

Ingredient ID: NPC483165

Ingredient ID: NPC483164

Ingredient ID: NPC483163

Ingredient ID: NPC43777

Ingredient ID: NPC37331

Ingredient ID: NPC36835

Ingredient ID: NPC331672

Ingredient ID: NPC32977

Ingredient ID: NPC329066

Ingredient ID: NPC327747

Ingredient ID: NPC323254

Ingredient ID: NPC322725

Ingredient ID: NPC319671

Ingredient ID: NPC318138

Ingredient ID: NPC308387

Ingredient ID: NPC305029

Ingredient ID: NPC303090

Ingredient ID: NPC302857

Ingredient ID: NPC301477

Ingredient ID: NPC300082

Ingredient ID: NPC29821

Ingredient ID: NPC298084

Ingredient ID: NPC297514

Ingredient ID: NPC294902

Ingredient ID: NPC290613

Ingredient ID: NPC29

Ingredient ID: NPC286016

Ingredient ID: NPC284948

Ingredient ID: NPC28318

Ingredient ID: NPC27939

Ingredient ID: NPC279121

Ingredient ID: NPC277771

Ingredient ID: NPC268724

Ingredient ID: NPC266573

Ingredient ID: NPC264910

Ingredient ID: NPC260491

Ingredient ID: NPC25684

Ingredient ID: NPC256032

Ingredient ID: NPC25475

Ingredient ID: NPC246162

Ingredient ID: NPC245020

Ingredient ID: NPC243702

Ingredient ID: NPC240476

Ingredient ID: NPC239643

Ingredient ID: NPC233443

Ingredient ID: NPC23188

Ingredient ID: NPC230301

Ingredient ID: NPC226988

Ingredient ID: NPC226669

Ingredient ID: NPC223549

Ingredient ID: NPC220297

Ingredient ID: NPC218927

Ingredient ID: NPC216385

Ingredient ID: NPC211009

Ingredient ID: NPC20791

Ingredient ID: NPC206001

Ingredient ID: NPC200996

Ingredient ID: NPC192638

Ingredient ID: NPC191254

Ingredient ID: NPC189592

Ingredient ID: NPC189142

Ingredient ID: NPC184991

Ingredient ID: NPC181437

Ingredient ID: NPC177118

Ingredient ID: NPC176740

Ingredient ID: NPC174937

Ingredient ID: NPC167976

Ingredient ID: NPC166577

Ingredient ID: NPC159635

Ingredient ID: NPC157288

Ingredient ID: NPC156353

Ingredient ID: NPC147100

Ingredient ID: NPC145139

Ingredient ID: NPC144511

Ingredient ID: NPC143989

Ingredient ID: NPC143062

Ingredient ID: NPC138408

Ingredient ID: NPC135942

Ingredient ID: NPC133671

Ingredient ID: NPC127019

Ingredient ID: NPC125613

Ingredient ID: NPC125062

Ingredient ID: NPC123117

Ingredient ID: NPC122318

Ingredient ID: NPC118248

Ingredient ID: NPC116775

Ingredient ID: NPC116603

Ingredient ID: NPC116461

Ingredient ID: NPC115557

Ingredient ID: NPC113733

Ingredient ID: NPC1075

Ingredient ID: NPC100887