• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Carissa Spinarum


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

TCGAATCCTGCAACAGACGACCCGTGAACTCGTTCAACCGCGGGCGCCGGGCGTGGGGGTCCCCCTTGCGCCCGGTGCCCCCCGGCCGGCCGGTGCCTTTGGCGCTCGGTCGTGCTAAACAACAAACCCCGGTGCGGAAAGCACCAAGGACTACTCAAATGGACAGCCTTCCCTCGGCTTTGCCCGTTCGCGGTGCGAGTCGTGGGAGCATAGGCGCCTGTCGTATCTAAAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO9099
Plant Latin Name: Carissa Spinarum
Taxonomy Genus: Carissa
Taxonomy Family: Apocynaceae

Plant External Links:

NCBI TaxonomyDB: 429256
Plant-of-the-World-Online: 77756-1

Used in Medicines

Country/Region:
India

Traditional Medicine System:

Geographical Distribution

Madagascar; Bangladesh; Sudan; Guinea; Nepal; Cambodia; Malawi; Ethiopia; Rwanda; Somalia; Laos; Nigeria; Cameroon; Cote d'Ivoire; Benin; Ghana; Saudi Arabia; Australia; Thailand; Zambia; Cape Verde; Burkina Faso; Togo; Zimbabwe; China; Germany; Eritrea; Oman; Tanzania; New Caledonia; Mauritius; Sri Lanka; Vietnam; Namibia; Guinea-Bissau; Mali; Senegal; Yemen; Pakistan; Seychelles; Angola; Myanmar; Chad; Egypt; India; Botswana; Djibouti; Congo; Mozambique; Uganda; Burundi; Kenya; Comoros

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

96 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


30 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

32 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC95920

Ingredient ID: NPC95692

Ingredient ID: NPC95381

Ingredient ID: NPC91604

Ingredient ID: NPC88186

Ingredient ID: NPC87898

Ingredient ID: NPC84956

Ingredient ID: NPC83733

Ingredient ID: NPC79835

Ingredient ID: NPC77184

Ingredient ID: NPC77112

Ingredient ID: NPC76902

Ingredient ID: NPC75742

Ingredient ID: NPC7479

Ingredient ID: NPC692

Ingredient ID: NPC64381

Ingredient ID: NPC63586

Ingredient ID: NPC61475

Ingredient ID: NPC58930

Ingredient ID: NPC56223

Ingredient ID: NPC50528

Ingredient ID: NPC46190

Ingredient ID: NPC4309

Ingredient ID: NPC39591

Ingredient ID: NPC37250

Ingredient ID: NPC33378

Ingredient ID: NPC32833

Ingredient ID: NPC31605

Ingredient ID: NPC310293

Ingredient ID: NPC30856

Ingredient ID: NPC307270

Ingredient ID: NPC307113

Ingredient ID: NPC304825

Ingredient ID: NPC304552

Ingredient ID: NPC303409

Ingredient ID: NPC296701

Ingredient ID: NPC285044

Ingredient ID: NPC284104

Ingredient ID: NPC274516

Ingredient ID: NPC273965

Ingredient ID: NPC270674

Ingredient ID: NPC268755

Ingredient ID: NPC267179

Ingredient ID: NPC26306

Ingredient ID: NPC262922

Ingredient ID: NPC25455

Ingredient ID: NPC251132

Ingredient ID: NPC250781

Ingredient ID: NPC243728

Ingredient ID: NPC243014

Ingredient ID: NPC242419

Ingredient ID: NPC240797

Ingredient ID: NPC235237

Ingredient ID: NPC235126

Ingredient ID: NPC232572

Ingredient ID: NPC230507

Ingredient ID: NPC230301

Ingredient ID: NPC22861

Ingredient ID: NPC227952

Ingredient ID: NPC22779

Ingredient ID: NPC2232

Ingredient ID: NPC222202

Ingredient ID: NPC217245

Ingredient ID: NPC216773

Ingredient ID: NPC216515

Ingredient ID: NPC212874

Ingredient ID: NPC205152

Ingredient ID: NPC204025

Ingredient ID: NPC195749

Ingredient ID: NPC188080

Ingredient ID: NPC184608

Ingredient ID: NPC181845

Ingredient ID: NPC180256

Ingredient ID: NPC179829

Ingredient ID: NPC1786

Ingredient ID: NPC176691

Ingredient ID: NPC175795

Ingredient ID: NPC171073

Ingredient ID: NPC16983

Ingredient ID: NPC169493

Ingredient ID: NPC161676

Ingredient ID: NPC161543

Ingredient ID: NPC160633

Ingredient ID: NPC15825

Ingredient ID: NPC153375

Ingredient ID: NPC151448

Ingredient ID: NPC147753

Ingredient ID: NPC145901

Ingredient ID: NPC139665

Ingredient ID: NPC129683

Ingredient ID: NPC129253

Ingredient ID: NPC126681

Ingredient ID: NPC122819

Ingredient ID: NPC119405

Ingredient ID: NPC119343

Ingredient ID: NPC113044