• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Patrinia Villosa


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAAACCTGCACAGCAGAACGACCCGCGAACACGTTCGTACACGGGGACGCCGGCCGCGAGGCCGGTGCTCCCATGGTAGCGGTGCCGTCCGGCTCCGCGGCCGCAAACCGAACCCCGGCGCGATCCGCGCCAAGGAACATGAAATCAGGAGGCGAGCTGCCAACCCAGCCGGCCCGTTCGCGGCGCGGGCTGGGCGAACGCTGACCCACCGGAAGAAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCCAAACCCGCTTCCAACGAAGTCGGCGCGCGGGGGGAGCGGACAGTGGCCTCCCGAGTCCCCGGGCTCGGTTGGCCTAAAATCGAGTCCCCGGCGGCGGACGTCACGACGAGTGGTGGTCGATACAGCCCTCTTATCGCGTCGTGCGTTTCCCCGTCGACCGGGCGACCAAGTGACCCTGACGCGTCGTCTTCCGACGTCGCTCCGACC

Click for details-----ITS1

TCGAAACCTGCACAGCAGAACGACCCGCGAACACGTTCGTACACGGGGACGCCGGCCGCGAGGCCGGTGCTCCCATGGTAGCGGTGCCGTCCGGCTCCGCGGCCGCAAACCGAACCCCGGCGCGATCCGCGCCAAGGAACATGAAATCAGGAGGCGAGCTGCCAACCCAGCCGGCCCGTTCGCGGCGCGGGCTGGGCGAACGCTGACCCACCGGAAGAAACACAAA

Click for details-----ITS2

ATCGCGTCGCCCCCCCAAAACCCGCTTCCAACGGAGTCGGCGTCGCGGGGGGAGCGGACAATGGCCTCCCGGGTCCCCGGGCTCGGCTGGCCTAAAATCGAGTCCCCGGCGGCGGACGTCACGACGAGTGGTGGTCGAAAAAGCCCTCTTATCGCGTCGTGCGTTTCCCCGTCGACCGGGCGACCAAGTGACCCTGACGCGTCGTCTTCCGACGGCGCTCCGACC
Taxonomic Information

Plant ID: NPO9090
Plant Latin Name: Patrinia Villosa
Taxonomy Genus: Patrinia
Taxonomy Family: Caprifoliaceae

Plant External Links:

NCBI TaxonomyDB: 183944
Plant-of-the-World-Online: 60452696-2

Used in Medicines

Country/Region:
China

Traditional Medicine System:
TCM


Medicinal Functions:

Antibacterial; Antiinflammatory; Hepatic

Geographical Distribution

Japan; Taiwan; China; South Africa

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

98 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


70 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

53 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC98925

Ingredient ID: NPC88278

Ingredient ID: NPC85185

Ingredient ID: NPC8466

Ingredient ID: NPC78612

Ingredient ID: NPC74539

Ingredient ID: NPC67920

Ingredient ID: NPC6520

Ingredient ID: NPC62840

Ingredient ID: NPC61248

Ingredient ID: NPC53545

Ingredient ID: NPC52403

Ingredient ID: NPC51700

Ingredient ID: NPC50898

Ingredient ID: NPC49151

Ingredient ID: NPC49134

Ingredient ID: NPC4899

Ingredient ID: NPC42471

Ingredient ID: NPC424

Ingredient ID: NPC42372

Ingredient ID: NPC34589

Ingredient ID: NPC33761

Ingredient ID: NPC33489

Ingredient ID: NPC33320

Ingredient ID: NPC328670

Ingredient ID: NPC323928

Ingredient ID: NPC32279

Ingredient ID: NPC317976

Ingredient ID: NPC306478

Ingredient ID: NPC305693

Ingredient ID: NPC304443

Ingredient ID: NPC304309

Ingredient ID: NPC301696

Ingredient ID: NPC301585

Ingredient ID: NPC301270

Ingredient ID: NPC295731

Ingredient ID: NPC291024

Ingredient ID: NPC290613

Ingredient ID: NPC290563

Ingredient ID: NPC29

Ingredient ID: NPC289774

Ingredient ID: NPC288537

Ingredient ID: NPC288254

Ingredient ID: NPC287967

Ingredient ID: NPC287397

Ingredient ID: NPC279121

Ingredient ID: NPC276332

Ingredient ID: NPC270908

Ingredient ID: NPC26974

Ingredient ID: NPC26960

Ingredient ID: NPC2665

Ingredient ID: NPC265197

Ingredient ID: NPC264949

Ingredient ID: NPC264711

Ingredient ID: NPC262505

Ingredient ID: NPC26229

Ingredient ID: NPC261831

Ingredient ID: NPC258019

Ingredient ID: NPC255607

Ingredient ID: NPC245735

Ingredient ID: NPC243509

Ingredient ID: NPC241721

Ingredient ID: NPC240328

Ingredient ID: NPC237837

Ingredient ID: NPC234536

Ingredient ID: NPC233533

Ingredient ID: NPC230301

Ingredient ID: NPC225562

Ingredient ID: NPC216630

Ingredient ID: NPC215324

Ingredient ID: NPC214710

Ingredient ID: NPC209970

Ingredient ID: NPC208936

Ingredient ID: NPC20791

Ingredient ID: NPC20742

Ingredient ID: NPC201844

Ingredient ID: NPC196442

Ingredient ID: NPC195000

Ingredient ID: NPC187892

Ingredient ID: NPC184824

Ingredient ID: NPC182102

Ingredient ID: NPC179831

Ingredient ID: NPC179464

Ingredient ID: NPC174552

Ingredient ID: NPC163556

Ingredient ID: NPC162310

Ingredient ID: NPC155183

Ingredient ID: NPC153958

Ingredient ID: NPC149203

Ingredient ID: NPC137949

Ingredient ID: NPC135020

Ingredient ID: NPC134616

Ingredient ID: NPC133671

Ingredient ID: NPC126004

Ingredient ID: NPC121664

Ingredient ID: NPC116076

Ingredient ID: NPC115891

Ingredient ID: NPC113928