• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Persicaria Tinctoria


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

TCGAAACCTGCACAAGCAGAAAGACCCGTGAACTCGTTTACAAACACCGGGCGGACGTCGTTCGGCCACAAACCGACGACGTCCCCCGAGCTCGNCAGGATCCCGGCTCCCAGTGGGTCGGTCTCCTCCGAGCACGAACAAACCCCGGCGCGGATTGCGCCAAGGACCATGAACAATAGCGCGTCCCACGCCCCTCGGTTGCCCGAAGTGAGCGTGGGTCGTCGTGTCGTTTCGATACATTAGAA

Click for details-----ITS2

ACCGCGTCGCCCCCCACCCAAACCATTGGGATGGGGGGCGGACTGTGGCCCCCCGTGCGCTCATCGCTCGCGGTCGGCCTAAACACAGACCCCGTGGCCGCGAAACGCCGCGACGTTTGGTGGTTTACTCGTGGCCCTGTGCCTCGAGCATCGCGTCGTGGCCTTGGCGGCCCATGGGAGCTCAAAGGACCCTGAGGAGGACCGTTCCACCCTCGAGTGGCGCCGGAACCTCCTAACCGTT
Taxonomic Information

Plant ID: NPO9069
Plant Latin Name: Persicaria Tinctoria
Taxonomy Genus: Persicaria
Taxonomy Family: Polygonaceae

Plant External Links:

NCBI TaxonomyDB: 96455
Plant-of-the-World-Online: 60455325-2

Used in Medicines

Country/Region:
South Korea

Traditional Medicine System:

Geographical Distribution

Ukraine; South Korea; China; South Africa

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

128 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


67 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

62 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99583

Ingredient ID: NPC94267

Ingredient ID: NPC89778

Ingredient ID: NPC88545

Ingredient ID: NPC85488

Ingredient ID: NPC83214

Ingredient ID: NPC75716

Ingredient ID: NPC7551

Ingredient ID: NPC65680

Ingredient ID: NPC62927

Ingredient ID: NPC62765

Ingredient ID: NPC61198

Ingredient ID: NPC57974

Ingredient ID: NPC57863

Ingredient ID: NPC5413

Ingredient ID: NPC53545

Ingredient ID: NPC43246

Ingredient ID: NPC40432

Ingredient ID: NPC39391

Ingredient ID: NPC35099

Ingredient ID: NPC34770

Ingredient ID: NPC3357

Ingredient ID: NPC3295

Ingredient ID: NPC31432

Ingredient ID: NPC313179

Ingredient ID: NPC310665

Ingredient ID: NPC307050

Ingredient ID: NPC305016

Ingredient ID: NPC303689

Ingredient ID: NPC302857

Ingredient ID: NPC302856

Ingredient ID: NPC301950

Ingredient ID: NPC295238

Ingredient ID: NPC295021

Ingredient ID: NPC294902

Ingredient ID: NPC294548

Ingredient ID: NPC293378

Ingredient ID: NPC290437

Ingredient ID: NPC289774

Ingredient ID: NPC288349

Ingredient ID: NPC287876

Ingredient ID: NPC284701

Ingredient ID: NPC284635

Ingredient ID: NPC278434

Ingredient ID: NPC277404

Ingredient ID: NPC274621

Ingredient ID: NPC27458

Ingredient ID: NPC273917

Ingredient ID: NPC270136

Ingredient ID: NPC269367

Ingredient ID: NPC258605

Ingredient ID: NPC257582

Ingredient ID: NPC257490

Ingredient ID: NPC257301

Ingredient ID: NPC254698

Ingredient ID: NPC254416

Ingredient ID: NPC249699

Ingredient ID: NPC249669

Ingredient ID: NPC243728

Ingredient ID: NPC23962

Ingredient ID: NPC235260

Ingredient ID: NPC230578

Ingredient ID: NPC230301

Ingredient ID: NPC228346

Ingredient ID: NPC227406

Ingredient ID: NPC226107

Ingredient ID: NPC226105

Ingredient ID: NPC225851

Ingredient ID: NPC224632

Ingredient ID: NPC21827

Ingredient ID: NPC209389

Ingredient ID: NPC20791

Ingredient ID: NPC207554

Ingredient ID: NPC207428

Ingredient ID: NPC206589

Ingredient ID: NPC203468

Ingredient ID: NPC19839

Ingredient ID: NPC195809

Ingredient ID: NPC19576

Ingredient ID: NPC192402

Ingredient ID: NPC191857

Ingredient ID: NPC19044

Ingredient ID: NPC189817

Ingredient ID: NPC187998

Ingredient ID: NPC187770

Ingredient ID: NPC18216

Ingredient ID: NPC179950

Ingredient ID: NPC178681

Ingredient ID: NPC173695

Ingredient ID: NPC173486

Ingredient ID: NPC172801

Ingredient ID: NPC172800

Ingredient ID: NPC17131

Ingredient ID: NPC167976

Ingredient ID: NPC164664

Ingredient ID: NPC161557

Ingredient ID: NPC158702

Ingredient ID: NPC158404

Ingredient ID: NPC158079

Ingredient ID: NPC157192

Ingredient ID: NPC156461

Ingredient ID: NPC155871

Ingredient ID: NPC154172

Ingredient ID: NPC152478

Ingredient ID: NPC150958

Ingredient ID: NPC150020

Ingredient ID: NPC149494

Ingredient ID: NPC147957

Ingredient ID: NPC146370

Ingredient ID: NPC144434

Ingredient ID: NPC14330

Ingredient ID: NPC133671

Ingredient ID: NPC131885

Ingredient ID: NPC128143

Ingredient ID: NPC123304

Ingredient ID: NPC12166

Ingredient ID: NPC121656

Ingredient ID: NPC119107

Ingredient ID: NPC116775

Ingredient ID: NPC115207

Ingredient ID: NPC114977

Ingredient ID: NPC114975

Ingredient ID: NPC113776

Ingredient ID: NPC112701

Ingredient ID: NPC111275

Ingredient ID: NPC111249

Ingredient ID: NPC1075

Ingredient ID: NPC103887